Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pBTK503 Resource Report Resource Website 1+ mentions |
RRID:Addgene_110616 | GFP | Synthetic | Ampicillin | PMID:29608282 | Vector Backbone:RSF1010; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:04 | 2 | ||
|
pBTK550d Resource Report Resource Website |
RRID:Addgene_110617 | GFP | Synthetic | Spectinomycin | PMID:29608282 | Vector Backbone:RSF1010; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | 2026-09-12 02:15:04 | 0 | ||
|
pBTK552 Resource Report Resource Website 1+ mentions |
RRID:Addgene_110618 | GFP | Synthetic | Spectinomycin | PMID:29608282 | Vector Backbone:RSF1010; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | 2026-09-12 02:15:04 | 1 | ||
|
pJM251 (miniCTX1-araC-ParaBAD) Resource Report Resource Website |
RRID:Addgene_110567 | araC-ParaBAD | Other | Tetracycline | PMID:27613678 | Backbone Marker:Herbert Schweizer; Backbone Size:5610; Vector Backbone:miniCTX1; Vector Types:Bacterial Expression; Bacterial Resistance:Tetracycline | 2026-09-12 02:15:03 | 0 | ||
|
pBTK599 Resource Report Resource Website |
RRID:Addgene_110600 | GFP dropout | Synthetic | Ampicillin | PMID:29608282 | Vector Backbone:R6K; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 0 | ||
|
pBTK599s Resource Report Resource Website |
RRID:Addgene_110601 | GFP dropout | Synthetic | Spectinomycin | PMID:29608282 | Vector Backbone:R6K; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin | 2026-09-12 02:15:03 | 0 | ||
|
EYFP-Talin1-FERM Resource Report Resource Website 1+ mentions |
RRID:Addgene_110565 | Talin 1 | Mus musculus | Ampicillin | Backbone Marker:Novagen; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 1 | |||
|
pBTK527 Resource Report Resource Website |
RRID:Addgene_110605 | Kanamycin | PMID:29608282 | Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-09-12 02:15:03 | 0 | ||||
|
pBTK519 Resource Report Resource Website 1+ mentions |
RRID:Addgene_110603 | GFP | Synthetic | Kanamycin | PMID:29608282 | Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-09-12 02:15:03 | 1 | ||
|
pBTK614 Resource Report Resource Website |
RRID:Addgene_110608 | dCas9 | Synthetic | Ampicillin | PMID:29608282 | Vector Backbone:ColE1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 0 | ||
|
pBTK615 Resource Report Resource Website |
RRID:Addgene_110609 | sgRNA | Synthetic | Ampicillin | PMID:29608282 | Vector Backbone:ColE1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 0 | ||
|
pBTK601 Resource Report Resource Website |
RRID:Addgene_110607 | Cas9 | Synthetic | Spectinomycin | PMID:29608282 | Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin | 2026-09-12 02:15:03 | 0 | ||
|
pcDNA3 Paf1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11059 | Paf1 | Homo sapiens | Ampicillin | PMID:15632063 | Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGGATCCATGGCGCCCACCATCCAG 3' and 5' CCGCTCGAGTCAGTCACTGTCACTATCAGCTTCACTG 3' | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 1 | |
|
p182 pK7-HDAC1 mut (GFP) Resource Report Resource Website 1+ mentions |
RRID:Addgene_11055 | HDAC1 | Mus musculus | Ampicillin | PMID:15060137 | Addgene sequencing data finds T189A and D332G substitutions. These are not known to affect function. | Backbone Size:0; Vector Backbone:pK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of aa 1-56: deacetylase domain deletion | 2026-09-12 02:15:03 | 2 |
|
p185 pK7-HDGF (GFP) Resource Report Resource Website |
RRID:Addgene_11058 | HDGF | Rattus norvegicus | Ampicillin | PMID:15060137 | *Note there is a Q104R mutation in the plasmid that is unlikely to affect plasmid function. | Backbone Size:0; Vector Backbone:pK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 0 | |
|
pcDNA3 HRPT2 L64P Resource Report Resource Website |
RRID:Addgene_11052 | HRPT2 L64P | Homo sapiens | Ampicillin | PMID:15632063 | Author has deposited insert sequence. Click on "sequence" to view. Used plasmid 11048 as a template for mutagenesis using the following primers: 5' G GAT TCC ATT TTA TTT CTA CCT AAT AAC GTG CAC CTT TCT C 3' and 5' G AGA AAG GAG CAC GTT ATT AGG TAG AAA TAA AAT GGA ATC C 3' | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | L64P | 2026-09-12 02:15:03 | 0 |
|
p181 pK7-HDAC1 (GFP) Resource Report Resource Website 1+ mentions |
RRID:Addgene_11054 | HDAC1 | Mus musculus | Ampicillin | PMID:15060137 | Backbone Size:0; Vector Backbone:pK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 6 | ||
|
p180 pCIG-HDAC1 mut Resource Report Resource Website 1+ mentions |
RRID:Addgene_11053 | HDAC1 | Mus musculus | Ampicillin | PMID:15060137 | pCIG drives simultaneous expression of GFP and inserted genes by virtue of an internal ribosome entry site. | Backbone Size:0; Vector Backbone:pCIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of aa 1-56: deacetylase domain deletion | 2026-09-12 02:15:03 | 1 |
|
MP28445 – pFUSE2ss-aRD114_CLIg-mIgK Resource Report Resource Website |
RRID:Addgene_110556 | anit-RD114 light chain | RD114 retrovirus | Blasticidin | PMID:31702531 | Backbone Marker:Invivogen; Backbone Size:3456; Vector Backbone:pFUSEss; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Blasticidin | 2026-09-12 02:15:03 | 0 | ||
|
pJM100 (pUC18T-miniTn7T-gm-araC-ParaBAD) Resource Report Resource Website |
RRID:Addgene_110554 | araC-ParaBAD | Other | Ampicillin | PMID:27613678 | Backbone Marker:Herbert Schweizer; Backbone Size:4569; Vector Backbone:pUC18T-miniTn7T-gm; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:03 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
