Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: cel-pre-let-7_LPC
Vector Backbone Description: Backbone Marker:Ambion; Backbone Size:2700; Vector Backbone:pDP19; Vector Types:transcription vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20808284
Comments: This construct does not produce perfect pre-let-7. There are leader and tail sequences from the backbone MCS. Used for in vitro translation.
Proper citation: RRID:Addgene_26561 Copy
Species: Caenorhabditis elegans
Genetic Insert: lin-41 3' UTR
Vector Backbone Description: Backbone Size:2742; Vector Backbone:pDPlk; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20808284
Proper citation: RRID:Addgene_26564 Copy
Species: Caenorhabditis elegans
Genetic Insert: lsm-1
Vector Backbone Description: Backbone Size:0; Vector Backbone:unknown; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18692039
Proper citation: RRID:Addgene_26939 Copy
Species: Caenorhabditis elegans
Genetic Insert: cgh-1
Vector Backbone Description: Backbone Size:0; Vector Backbone:unknown; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18692039
Proper citation: RRID:Addgene_26940 Copy
Species: Caenorhabditis elegans
Genetic Insert: unc-119 rescuing fragment/pie-1promoter-gateway destination cassette B- pie-1 3’
Vector Backbone Description: Backbone Size:17037; Vector Backbone:pie-1; Vector Types:Worm Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18692039
Comments: Second Generation pie-1 vector for expressing ORFs in the germline
Proper citation: RRID:Addgene_26955 Copy
Species: Caenorhabditis elegans
Genetic Insert: beta-tubulin
Vector Backbone Description: Backbone Size:0; Vector Backbone:pie-1; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18692039
Comments: 1st generation pie-1 vector
Proper citation: RRID:Addgene_26951 Copy
Species: Caenorhabditis elegans
Genetic Insert: TRA-2 GFP
Vector Backbone Description: Backbone Size:2700; Vector Backbone:pPD95.79; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20921392
Proper citation: RRID:Addgene_27128 Copy
Species: Caenorhabditis elegans
Genetic Insert: TRA-2 FLAG
Vector Backbone Description: Backbone Size:2700; Vector Backbone:pPD95.79; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20921392
Comments: Cloning of this plasmid was achieved in the following steps:
(1)the sequence 3' (3'UTR) of the tags was added by (EcoRI/SpeI)
(2) 1.2 kb XhoI/KpnI tra-2 pcr fragment into SalI/KpnI cut vector (destroying one SalI/XhoI site but adding another in the insert) immediately 5' of the tag
(3) 7 kb HindIII/SalI fragment into same that partially replaced fragment added in step 2 containing most of the TRA-2 coding sequence
(4) 5 kb Xho/AgeI that added the promoter and upstream gene in the operon as well as some Tra-2 coding sequence
Proper citation: RRID:Addgene_27129 Copy
Species: Caenorhabditis elegans
Genetic Insert: Dre-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5404; Vector Backbone:pcDNA3.1-; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24613396
Proper citation: RRID:Addgene_52513 Copy
Species: Caenorhabditis elegans
Genetic Insert: blmp-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5421; Vector Backbone:pcDNA3.1-; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24613396
Proper citation: RRID:Addgene_52514 Copy
Species: Caenorhabditis elegans
Genetic Insert: CTL2 of PIEZO1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25242456
Proper citation: RRID:Addgene_92212 Copy
Species: Caenorhabditis elegans
Genetic Insert: RSF-1
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23103556
Proper citation: RRID:Addgene_66862 Copy
Species: Caenorhabditis elegans
Genetic Insert: Let-60
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23103556
Proper citation: RRID:Addgene_66860 Copy
Species: Caenorhabditis elegans
Genetic Insert: YPET-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26044593
Comments: IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined.
Proper citation: RRID:Addgene_66824 Copy
Species: Caenorhabditis elegans
Genetic Insert: GFP-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26044593
Comments: IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined.
Sequence note: The full sequence is based on Addgene NGS of our stock. There may be some slight but innocuous inconsistencies with the depositor's GenBank files. One discrepancy affects the sequence of the 3' arm reverse primer (Table P1 and Figure P1) from the associated publication. The first g from the 3' end is missing:[tcacacaggaaacagctatgaccatgttat] -> [tcacacaggaaacagctatgaccatttat]
Proper citation: RRID:Addgene_66823 Copy
Species: Caenorhabditis elegans
Genetic Insert: C.elegans YAP-1
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:PD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23396260
Comments: I performed PCR on C.elegans genome to isolate the genome of YAP-1 which contain 5' UTR and the coding exons and introns. I subcloned the product into PstI/SmaI sites of PD95.75, so that GFP is fused to the last exon. Serine 104 was mutated to alanine.
Proper citation: RRID:Addgene_66857 Copy
Species: Caenorhabditis elegans
Genetic Insert: EGL-44
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23396260
Proper citation: RRID:Addgene_66855 Copy
Species: Caenorhabditis elegans
Genetic Insert: WTS-1
Vector Backbone Description: Backbone Marker:Eastman Kodak Company; Backbone Size:4700; Vector Backbone:pFLAG-CMV-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23396260
Proper citation: RRID:Addgene_66856 Copy
Species: Caenorhabditis elegans
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:Not Available; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26712014
Proper citation: RRID:Addgene_68120 Copy
Species: Caenorhabditis elegans
Genetic Insert: H2FLK4_CAEEL
Vector Backbone Description: Vector Backbone:YK 02; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35176859
Comments: This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis). See supplemental table 2 in our paper to see its performance in our assay. The negative control for this assay is pSecTag2 B which can be obtained from Thermo here https://www.thermofisher.com/order/catalog/product/V90020
Proper citation: RRID:Addgene_185171 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
