Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,423 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pDONR221-kcnma1a
 
Resource Report
Resource Website 		RRID:Addgene_164951 kcnma1a Danio rerio Kanamycin PMID:33728688 The DNA sequence was amplified from pooled wild type TAB zebrafish embryos. There is a likely polymorphism, N416D, which is not listed in the current ENSEMBL database. This is possibly due to incomplete zebrafish genome annotation, GRCz11. But this will not impact the result of whole mount in situ hybridization Backbone Marker:Invitrogen; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin 2026-08-01 01:07:23 0
pDestTol2-pax3a-kcnj13-IRES-EGFP
 
Resource Report
Resource Website 		RRID:Addgene_164950 kcnj13 Danio rerio Ampicillin PMID:32546498 Backbone Size:4179; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 transposon destination vector; Bacterial Resistance:Ampicillin 2026-08-01 01:07:23 0
pENTR-D-TOPO-kcnmb3
 
Resource Report
Resource Website 		RRID:Addgene_164955 kcnmb3 Danio rerio Kanamycin PMID:33728688 Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin 2026-08-01 01:07:31 0
pENTR-D-TOPO-kcnn1a
 
Resource Report
Resource Website 		RRID:Addgene_164956 kcnn1a Danio rerio Kanamycin PMID:33728688 The DNA sequence was amplified from pooled wild-type TAB zebrafish embryos. According to the predicted sequence, XP_005171293.1, there are likely polymorphisms, K185E, H323Y, S599N, which are not listed in the current ENSEMBL database. This is possibly due to incomplete zebrafish genome annotation, GRCz11. In addition, at the 5’ end of the insert, there are 44bps extra forward primer dimer sequences (ATGCGGCATCGGCACGCGGGCCATGCGGCATCGGCACGCGGGCC) before the start codon. But this will not impact the result of the whole mount in situ hybridization. Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin 2026-08-01 01:07:23 0
pENTR-D-TOPO-kcnmb2a
 
Resource Report
Resource Website 		RRID:Addgene_164953 kcnmb2a Danio rerio Kanamycin PMID:33728688 Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR Cloning Vectror; Bacterial Resistance:Kanamycin 2026-08-01 01:07:23 0
pENTR-D-TOPO-kcnn3
 
Resource Report
Resource Website 		RRID:Addgene_164959 kcnn3 Danio rerio Kanamycin PMID:33728688 Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin 2026-08-01 01:07:23 0
pENTR-D-TOPO-kcnn1b
 
Resource Report
Resource Website 		RRID:Addgene_164957 kcnn1b Danio rerio Kanamycin PMID:33728688 Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin 2026-08-01 01:07:23 0
pENTR-D-TOPO-kcnn2
 
Resource Report
Resource Website 		RRID:Addgene_164958 kcnn2 Danio rerio Kanamycin PMID:33728688 Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin 2026-08-01 01:07:31 0
pDestTol2-actinb-kcnj13-IRES-EGFP
 
Resource Report
Resource Website 		RRID:Addgene_164941 kcnj13 Danio rerio Ampicillin PMID:32546498 Backbone Size:4179; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 transposon destination vector; Bacterial Resistance:Ampicillin 2026-08-01 01:07:23 0
L4417
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_1649 Ampicillin See Fire Lab Vector Kit Documentation 1999. Fire Lab Miniprep Number pPD128.110, Ligation number L4417. Backbone Size:3489; Vector Types:Worm Expression, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:07:31 5
pDestTol2-actinb-kcnj13-M135R-EGFP
 
Resource Report
Resource Website 		RRID:Addgene_164944 kcnj13 Danio rerio Ampicillin PMID:32546498 Backbone Size:4179; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 transposon destination vector; Bacterial Resistance:Ampicillin Stop codon deleted; M135R 2026-08-01 01:07:23 0
pDestTol2-actinb-kcnj13-Q153H-EGFP
 
Resource Report
Resource Website 		RRID:Addgene_164943 kcnj13 Danio rerio Ampicillin PMID:32546498 Backbone Size:4179; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 transposon destination vector; Bacterial Resistance:Ampicillin Stop codon deleted; Q153H; M154I 2026-08-01 01:07:31 0
pDestTol2-actinb-kcnk9-IRES-EGFP
 
Resource Report
Resource Website 		RRID:Addgene_164949 kcnk9 Danio rerio Ampicillin PMID:32546498 Backbone Size:4179; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 transposon destination vector; Bacterial Resistance:Ampicillin 2026-08-01 01:07:23 0
pDestTol2-actinb-kcnj1b-IRES-EGFP
 
Resource Report
Resource Website 		RRID:Addgene_164946 kcnj1b Danio rerio Ampicillin PMID:32546498 Backbone Size:4179; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 transposon destination vector; Bacterial Resistance:Ampicillin 2026-08-01 01:07:31 0
pDestTol2-actinb-kcnj10a-IRES-EGFP
 
Resource Report
Resource Website 		RRID:Addgene_164947 kcnj10a Danio rerio Ampicillin PMID:32546498 Backbone Size:4179; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 transposon destination vector; Bacterial Resistance:Ampicillin 2026-08-01 01:07:23 0
pGEMHE-POLArISact
 
Resource Report
Resource Website 		RRID:Addgene_164970 POLArISact Synthetic Ampicillin PMID:33674463 Please visit https://www.biorxiv.org/content/10.1101/2020.06.20.116178v2 full for bioRxiv preprint. Vector Backbone:pGEMHE; Vector Types:in vitro Transcription; Bacterial Resistance:Ampicillin 2026-08-01 01:07:23 0
pLVX-NPC1(P691S)-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_164973 NPC1 Homo sapiens Ampicillin PMID:33308480 Backbone Marker:Clontech; Backbone Size:9519; Vector Backbone:pLVX-AcGFP-N1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin P691S 2026-08-01 01:07:23 0
POLArISact
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_164971 POLArISact Synthetic Ampicillin PMID:33674463 Please visit https://www.biorxiv.org/content/10.1101/2020.06.20.116178v2 full for bioRxiv preprint. Backbone Marker:Zhao et. al. DOI: 10.1126/science.1208592; Vector Backbone:modified pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:07:31 1
pLVX-NPC1(P202A/F203A)-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_164976 NPC1 Homo sapiens Ampicillin PMID:33308480 Backbone Marker:Clontech; Backbone Size:9519; Vector Backbone:pLVX-AcGFP-N1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin P202A/ F203A 2026-08-01 01:07:23 0
pLJM1 FLCN (F118D) FLAG GFP
 
Resource Report
Resource Website 		RRID:Addgene_164979 FLCN Homo sapiens Ampicillin PMID:31672913 Vector Backbone:PLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin F118D 2026-08-01 01:07:23 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join Dr. Chen Li for a Knowledge Portal Network Webinar on the dkNET Computational Core on August 6

Join NIH ODSS Data Sharing and Reuse Seminar "PanKbase: An Open, FAIR Knowledge Base of the Human Pancreas to Accelerate Diabetes Research"

Join the NIDDK-CR Webinar "Design Patterns for Reproducible Research" on July 29, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch