Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5808; Vector Backbone:pCS2+; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: pCS2+ was digested with Stu I and ligated with the Reading Frame B Gateway cassette
Proper citation: RRID:Addgene_22423 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5800; Vector Backbone:pCS2+; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: pCSDest was digested with PstI and XhoI to remove the attR2 site and was replaced with an attR3 site from pDESTR4-R3
Proper citation: RRID:Addgene_22424 Copy
Species: Drosophila melanogaster
Genetic Insert: Argonaut-1, variant A
Vector Backbone Description: Backbone Marker:Elisa Izaurralde; Backbone Size:5455; Vector Backbone:pac5.1B-lambdaN; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22420 Copy
Species: Homo sapiens
Genetic Insert: F6
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22438 Copy
Species: Homo sapiens
Genetic Insert: F6 Sp-1 mut
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Sp1 mutation (−103) oligo is - GGATAGGGACTGGGCGAGG
Proper citation: RRID:Addgene_22439 Copy
Species: Homo sapiens
Genetic Insert: F4
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22434 Copy
Species: Homo sapiens
Genetic Insert: F4 GATA mut
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: GATA mutation oigo -
GCTCCCACTTTAGAGCCTCAGT
Proper citation: RRID:Addgene_22435 Copy
Species: Homo sapiens
Genetic Insert: F5
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22436 Copy
Species: Homo sapiens
Genetic Insert: F3 GATA Sp-1 mut
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: The forward primer used for the Sp1 mutations (-103) was GGATAGGGACTGGGCGAGG.
GATA mutation oigo -
GCTCCCACTTTAGAGCCTCAGT.
Proper citation: RRID:Addgene_22431 Copy
Species: Homo sapiens
Genetic Insert: F3 Sp-1 mut
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: Forward primer used to create Sp-1 mutation: GGATAGGGACTGGGCGAGG
Proper citation: RRID:Addgene_22432 Copy
Species: Homo sapiens
Genetic Insert: Human genomic PLP
Vector Backbone Description: Backbone Marker:Fermentas; Backbone Size:2862; Vector Backbone:pTZ19R; Vector Types:phagemid; Bacterial Resistance:Ampicillin
References:
Comments: Genomic DNA from an EMBL3 human genomic library. Contains 3' end of Exon1, Intron 1, Exon 2 and Intron 2
Proper citation: RRID:Addgene_22647 Copy
Species: Rattus norvegicus
Genetic Insert: Myelin Transcription Factor 1L
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Cloning and RNA Synthesis; Bacterial Resistance:Ampicillin
References:
Comments: Used to make riboprobes by cutting with SmaI and transcribing with SP6 polymerase to give a 980 bp riboprobe for RNA analysis on Northern blots
This Rat Myt1 DNA cloned by Hudson lab.
Proper citation: RRID:Addgene_22649 Copy
Species: Homo sapiens
Genetic Insert: BAP1
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22539 Copy
Species: Mus musculus
Genetic Insert: Proteolipid Protein
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2867; Vector Backbone:pGEM3; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
References:
Comments: Contains entire coding region of the mouse PLP cDNA including part of the 5' UTR. Used to make riboprobes by transcribing with SP6 polymerase to give a 980 bp antisense riboprobe or transcribing with T7 polymerase to give a 980bp sense riboprobe for RNA analysis on Northern blots.
This PLP DNA cloned by Hudson lab.
Proper citation: RRID:Addgene_22651 Copy
Species: Mus musculus
Genetic Insert: Ror2 delta Ig
Vector Backbone Description: Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22629 Copy
Species: Homo sapiens
Genetic Insert: human genomic PLP promoter region
Vector Backbone Description: Backbone Marker:R. McKinnon; Backbone Size:4728; Vector Backbone:p18CAT; Vector Types:CAT reporter plasmid; Bacterial Resistance:Ampicillin
References:
Comments: Insert is 4200bp (approx) of the Human PLP 5' upstream, promoter region and Exon1 (-4200 to +85) in the correct orientation. Insert is a BamHI/HindIII from pJB010
This PLP DNA cloned by Hudson lab.
Proper citation: RRID:Addgene_22624 Copy
Species: Homo sapiens
Genetic Insert: human genomic PLP promoter region
Vector Backbone Description: Backbone Marker:R. McKinnon; Backbone Size:4728; Vector Backbone:p18CAT; Vector Types:CAT reporter plasmid; Bacterial Resistance:Ampicillin
References:
Comments: Insert is 30bp ) of the Human PLP 5' upstream, promoter region and Exon1 (-18 to +12) in the correct orientation.
This PLP DNA cloned by Hudson lab.
Proper citation: RRID:Addgene_22625 Copy
Species: Homo sapiens
Genetic Insert: human genomic PLP promoter region
Vector Backbone Description: Backbone Marker:R. McKinnon; Backbone Size:4728; Vector Backbone:p18CAT; Vector Types:CAT reporter plasmid; Bacterial Resistance:Ampicillin
References:
Comments: Insert is 1200bp (approx) of the Human PLP 5' upstream, promoter region and Exon1 (-1088 to +85) in the correct orientation. Site 3 (bp -117 to -116) were mutated via Site-Directed Mutagenesis from GG to cc.
This PLP DNA cloned by Hudson lab.
Proper citation: RRID:Addgene_22626 Copy
Species: Homo sapiens
Genetic Insert: USP50
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22588 Copy
Species: Homo sapiens
Genetic Insert: human genomic PLP promoter region
Vector Backbone Description: Backbone Marker:R. McKinnon; Backbone Size:4728; Vector Backbone:p18CAT; Vector Types:CAT reporter plasmid; Bacterial Resistance:Ampicillin
References:
Comments: Insert is 1200bp (approx) of the Human PLP 5' upstream, promoter region and Exon1 (-1088 to +85) in the correct orientation
This PLP DNA cloned by Hudson lab.
Proper citation: RRID:Addgene_22623 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
