Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,423 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
SFG.wtCNb_opt.IRES.eGFP
 
Resource Report
Resource Website 		RRID:Addgene_22492 Codon optimised wild type Calcineurin B Homo sapiens Ampicillin PMID:19770360 Backbone Size:7678; Vector Backbone:SFG; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-07-25 12:44:33 0
SFG.CNa12_opt.IRES.eGFP
 
Resource Report
Resource Website 		RRID:Addgene_22490 Codon optimised Calcineurin A mutant 12 Homo sapiens Ampicillin PMID:19770360 Backbone Size:7678; Vector Backbone:SFG; Vector Types:Retroviral; Bacterial Resistance:Ampicillin T351E; L354A 2026-07-25 12:44:33 0
pSicoR (Puro) NEMO shRNA1
 
Resource Report
Resource Website 		RRID:Addgene_22505 NEMO shRNA1 Mus musculus Ampicillin PMID:19847165 Mouse NEMO shRNA1 in pSicoReverse (Puromycin) forward oligo: TGGACATGCTGGGTGAAGAATTCAAGAGATTCTTCACCCAGCATGTCCTTTTTTC reverse oligo : TCGAGAAAAAAGGACATGCTGGGTGAAGAATCTCTTGAATTCTTCACCCAGCATGTCCA Backbone Marker:Available at Addgene (#12084); Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin 2026-07-25 12:44:33 0
pBTR1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22468 cytochrome c Homo sapiens Ampicillin PMID:14680826 For an explanation of the cytochrome c expression system, see "Bacterial expression of a mitochondrial cytochrome c. Trimethylation of lys72 in yeast iso-1-cytochrome c and the alkaline conformational transition." by Pollock et al. PMID 9558351 Backbone Marker:PMID 9558351); Backbone Size:5279; Vector Backbone:pBCYC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:33 7
p3Eegfp
 
Resource Report
Resource Website 		RRID:Addgene_22462 EGFP Kanamycin PMID:17948311 This clone was amplified with an attB2 site, at the 5’ end and a attB3 site on the 3’ end. The product was then recombined with the pDNR P2R-P3 vector. Can be used to make 3’ end (C-Term) tagged fusion construct. Backbone Size:3000; Vector Backbone:pDONRP2r-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-07-25 12:44:33 0
pENTRegfp3
 
Resource Report
Resource Website 		RRID:Addgene_22464 EGFP Kanamycin PMID:17948311 Egfp ORF was amplified with an attB1 site on the 5’ end and an attB2 site on the 3’ end. ORF is in frame with 3’ entry clone. Egfp ORF missing the termination codon. Backbone Size:5000; Vector Backbone:pDONR; Vector Types:Entry clone; Bacterial Resistance:Kanamycin 2026-07-25 12:44:33 0
pCSegfpcherry
 
Resource Report
Resource Website 		RRID:Addgene_22465 EGFP-mCherry Ampicillin PMID:17948311 pEntregfp3, p3Emcherry, and pCSDest2 were combined in a multisite reaction to create an expression clone where egfp (minus stop codon) is fused in frame with a C terminal mcherry tag Backbone Size:5000; Vector Backbone:pCS2+; Vector Types:Injection construct; Bacterial Resistance:Ampicillin 2026-07-25 12:44:33 0
pwM
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22515 MCPyV VP1 Merkel Cell Polyomavirus Bleocin (Zeocin) PMID:19750217 First reference to this plasmid was in: Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6 Genbank style annotations can be found at: http://home.ccr.cancer.gov/LCO/packaging.htm Backbone Size:5338; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) codon modified gene 2026-07-25 12:44:33 6
FUtdTW
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_22478 tandem dimer tomato Discosoma sp Ampicillin PMID:18162542 pFUGW-tdtomato Backbone Marker:I. Verma, Salk; Backbone Size:9165; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:44:33 10
pJA281
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22513 Pmex-5::mCherry (w introns w/o stop) Caenorhabditis elegans Kanamycin PMID:21637852 Backbone Marker:Invitrogen; Backbone Size:2646; Vector Backbone:pDONRP4P1R; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin 2026-07-25 12:44:33 2
pAL101
 
Resource Report
Resource Website 		RRID:Addgene_22474 PIF6APB Mus musculus Ampicillin PMID:19749742 Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-07-25 12:44:33 0
pAL113
 
Resource Report
Resource Website 		RRID:Addgene_22471 PhyB NT Mus musculus Ampicillin PMID:19749742 Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin Y276H 2026-07-25 12:44:33 0
GST-Cav (135-178)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22448 Caveolin 1 Canis lupus familiaris Ampicillin PMID:9325253 Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin aa 135-178 2026-07-25 12:44:33 2
GST-Cav (1-61)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22446 Caveolin1 (1-61) Canis lupus familiaris Ampicillin PMID:9325253 Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:33 2
GST-Cav (61-101)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22447 Caveolin1 (61-101) Canis lupus familiaris Ampicillin PMID:9325253 Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:33 2
CMV-d2eGFP-16
 
Resource Report
Resource Website 		RRID:Addgene_22442 CMV d2eGFP miR-16 sponge Ampicillin PMID:17694064 From supplementary Table 1: miR-16 bulged Renilla luciferase reporter, CMV sponge, and U6 sponge, 9 sites: "AAUAUUCUAUGCUGCUA" Backbone Size:5000; Vector Backbone:pcDNA5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:33 0
pCDNA3.1-Myoferlin HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22443 Myoferlin Homo sapiens Ampicillin PMID:17702744 Please note that the myoferlin insert in this plasmid contains K110R, K605R and I1821V mutations when compared to GenBank reference sequence AF182316. It is not known if these are polymorphisms or PCR artifacts. The source of the human myoferlin gene used in this plasmid is described in the following publication: https://www.ncbi.nlm.nih.gov/pubmed/17702744 Backbone Marker:Invitrogen; Backbone Size:5467; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:33 8
pENTRbasEGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22453 EGFP Kanamycin PMID:17948311 Backbone Size:3000; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-07-25 12:44:33 3
pGL2 enhancer- F1 LUC
 
Resource Report
Resource Website 		RRID:Addgene_22426 eNOS promotor F1 Homo sapiens Ampicillin PMID:7541039 Backbone Size:5854; Vector Backbone:pGL2- Enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-07-25 12:44:33 0
pGL2 enhancer- F3 LUC
 
Resource Report
Resource Website 		RRID:Addgene_22429 F3 Homo sapiens Ampicillin PMID:7541039 Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-07-25 12:44:33 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join NIH ODSS Data Sharing and Reuse Seminar "PanKbase: An Open, FAIR Knowledge Base of the Human Pancreas to Accelerate Diabetes Research"

Join the NIDDK-CR Webinar "Design Patterns for Reproducible Research" on July 29, 2026

dkNET Showcases AI-Driven Biomedical Data Science Innovations at ISMB 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch