Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Codon optimised wild type Calcineurin B
Vector Backbone Description: Backbone Size:7678; Vector Backbone:SFG; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22492 Copy
Species: Homo sapiens
Genetic Insert: Codon optimised Calcineurin A mutant 12
Vector Backbone Description: Backbone Size:7678; Vector Backbone:SFG; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22490 Copy
Species: Mus musculus
Genetic Insert: NEMO shRNA1
Vector Backbone Description: Backbone Marker:Available at Addgene (#12084); Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Mouse NEMO shRNA1 in pSicoReverse (Puromycin)
forward oligo:
TGGACATGCTGGGTGAAGAATTCAAGAGATTCTTCACCCAGCATGTCCTTTTTTC
reverse oligo :
TCGAGAAAAAAGGACATGCTGGGTGAAGAATCTCTTGAATTCTTCACCCAGCATGTCCA
Proper citation: RRID:Addgene_22505 Copy
Species: Homo sapiens
Genetic Insert: cytochrome c
Vector Backbone Description: Backbone Marker:PMID 9558351); Backbone Size:5279; Vector Backbone:pBCYC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: For an explanation of the cytochrome c expression system, see "Bacterial expression of a mitochondrial cytochrome c. Trimethylation of lys72 in yeast iso-1-cytochrome c and the alkaline conformational transition." by Pollock et al. PMID 9558351
Proper citation: RRID:Addgene_22468 Copy
Species:
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pDONRP2r-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
References:
Comments: This clone was amplified with an attB2 site, at the 5’ end and a attB3 site on the 3’ end. The product was then recombined with the pDNR P2R-P3 vector.
Can be used to make 3’ end (C-Term) tagged fusion construct.
Proper citation: RRID:Addgene_22462 Copy
Species:
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pDONR; Vector Types:Entry clone; Bacterial Resistance:Kanamycin
References:
Comments: Egfp ORF was amplified with an attB1 site on the 5’ end and an attB2 site on the 3’ end. ORF is in frame with 3’ entry clone.
Egfp ORF missing the termination codon.
Proper citation: RRID:Addgene_22464 Copy
Species:
Genetic Insert: EGFP-mCherry
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCS2+; Vector Types:Injection construct; Bacterial Resistance:Ampicillin
References:
Comments: pEntregfp3, p3Emcherry, and pCSDest2 were combined in a multisite reaction to create an expression clone where egfp (minus stop codon) is fused in frame with a C terminal mcherry tag
Proper citation: RRID:Addgene_22465 Copy
Species: Merkel Cell Polyomavirus
Genetic Insert: MCPyV VP1
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: First reference to this plasmid was in:
Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6
Genbank style annotations can be found at:
http://home.ccr.cancer.gov/LCO/packaging.htm
Proper citation: RRID:Addgene_22515 Copy
Species: Discosoma sp
Genetic Insert: tandem dimer tomato
Vector Backbone Description: Backbone Marker:I. Verma, Salk; Backbone Size:9165; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: pFUGW-tdtomato
Proper citation: RRID:Addgene_22478 Copy
Species: Caenorhabditis elegans
Genetic Insert: Pmex-5::mCherry (w introns w/o stop)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2646; Vector Backbone:pDONRP4P1R; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22513 Copy
Species: Mus musculus
Genetic Insert: PIF6APB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22474 Copy
Species: Mus musculus
Genetic Insert: PhyB NT
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22471 Copy
Species: Canis lupus familiaris
Genetic Insert: Caveolin 1
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22448 Copy
Species: Canis lupus familiaris
Genetic Insert: Caveolin1 (1-61)
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22446 Copy
Species: Canis lupus familiaris
Genetic Insert: Caveolin1 (61-101)
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22447 Copy
Species:
Genetic Insert: CMV d2eGFP miR-16 sponge
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: From supplementary Table 1: miR-16 bulged Renilla luciferase reporter, CMV sponge, and U6 sponge, 9 sites:
"AAUAUUCUAUGCUGCUA"
Proper citation: RRID:Addgene_22442 Copy
Species: Homo sapiens
Genetic Insert: Myoferlin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5467; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note that the myoferlin insert in this plasmid contains K110R, K605R and I1821V mutations when compared to GenBank reference sequence AF182316. It is not known if these are polymorphisms or PCR artifacts.
The source of the human myoferlin gene used in this plasmid is described in the following publication: https://www.ncbi.nlm.nih.gov/pubmed/17702744
Proper citation: RRID:Addgene_22443 Copy
Species:
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22453 Copy
Species: Homo sapiens
Genetic Insert: eNOS promotor F1
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2- Enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22426 Copy
Species: Homo sapiens
Genetic Insert: F3
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22429 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
