Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 80 showing 1581 ~ 1600 out of 739,423 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_22163

    This resource has 1+ mentions.

http://www.addgene.org/22163

Species: Homo sapiens
Genetic Insert: human Dynamin 1aa
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_22163 Copy   


  • RRID:Addgene_22284

    This resource has 1+ mentions.

http://www.addgene.org/22284

Species: Homo sapiens
Genetic Insert: calcium-modulating ligand
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22284 Copy   


  • RRID:Addgene_22285

    This resource has 1+ mentions.

http://www.addgene.org/22285

Species: mixture
Genetic Insert: EGFP-ER
Vector Backbone Description: Backbone Size:6959; Vector Backbone:pMH4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: EGFP(A206K)= 925-1707 Calreticulin sgnalseq.=862-912 KDEL coding seq.=1714-1725

Proper citation: RRID:Addgene_22285 Copy   


  • RRID:Addgene_22280

http://www.addgene.org/22280

Species: Arabidopsis thaliana
Genetic Insert: p!SV40-PakGBD-mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4864; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22280 Copy   


  • RRID:Addgene_22160

http://www.addgene.org/22160

Species: Homo sapiens
Genetic Insert: hBEN
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Homologous to mouse BEN 1alpha1 isoform

Proper citation: RRID:Addgene_22160 Copy   


  • RRID:Addgene_22281

    This resource has 1+ mentions.

http://www.addgene.org/22281

Species: Arabidopsis thaliana
Genetic Insert: p!SV40-mCherry-WaspGBD
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5216; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22281 Copy   


http://www.addgene.org/22218

Species: Homo sapiens
Genetic Insert: Snk/Plk2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1/V5-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Human Snk/Plk2 was amplified from a human fetal brain cDNA library (Clontech) using PFU Turbo (Invitrogen) using the following primers: 5' CGC GGA TCC GCG ACC ATG GAG CTT TTG 3' and 5' CCG CTC GAG GTT ACA TCT TTG TAA GAG CAT 3'.

Proper citation: RRID:Addgene_22218 Copy   


http://www.addgene.org/22219

Species: Homo sapiens
Genetic Insert: Snk/Plk2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1/V5-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Human Snk/Plk2 was amplified from a human fetal brain cDNA library (Clontech) using PFU Turbo (Invitrogen) using the following primers: 5' CGC GGA TCC GCG ACC ATG GAG CTT TTG 3' and 5' CCG CTC GAG GTT ACA TCT TTG TAA GAG CAT 3'.

Proper citation: RRID:Addgene_22219 Copy   


  • RRID:Addgene_22214

    This resource has 1+ mentions.

http://www.addgene.org/22214

Species: Homo sapiens
Genetic Insert: Tuba
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22214 Copy   


  • RRID:Addgene_22216

http://www.addgene.org/22216

Species: Drosophila melanogaster
Genetic Insert: SCP1 (super core promoter 1)-CMVenh luciferase
Vector Backbone Description: Backbone Size:5500; Vector Backbone:Vector Backbone: a MODIFIED version (constructed by us) of Invit; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22216 Copy   


  • RRID:Addgene_22211

    This resource has 1+ mentions.

http://www.addgene.org/22211

Species: Homo sapiens
Genetic Insert: SA-OCT-GFP-2APuro-PA
Vector Backbone Description: Backbone Size:5468; Vector Backbone:N/A; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22211 Copy   


  • RRID:Addgene_22212

    This resource has 10+ mentions.

http://www.addgene.org/22212

Species: Homo sapiens
Genetic Insert: CAGGS-eGFP
Vector Backbone Description: Backbone Size:7357; Vector Backbone:N/A; Vector Types:ZFN donor; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid contains a ccdB gene that is non-functional.

Proper citation: RRID:Addgene_22212 Copy   


  • RRID:Addgene_22265

    This resource has 1+ mentions.

http://www.addgene.org/22265

Species:
Genetic Insert: Tetracycline repressor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2386; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Yeast Expression, Worm Expression, Insect Expression; Bacterial Resistance:Kanamycin
References:
Comments: Please note that there are several sequence discrepancies between Addgene's quality control sequence and the depositor's reference sequence. These changes do not affect plasmid function.

Proper citation: RRID:Addgene_22265 Copy   


  • RRID:Addgene_22266

    This resource has 1+ mentions.

http://www.addgene.org/22266

Species:
Genetic Insert: Enhanced Green Fluorescent Protein
Vector Backbone Description: Backbone Marker:Eric Campeau; Backbone Size:6869; Vector Backbone:pQCXIB; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22266 Copy   


  • RRID:Addgene_22260

    This resource has 1+ mentions.

http://www.addgene.org/22260

Species: Homo sapiens
Genetic Insert: cyclin-dependent kinase inhibitor 2A
Vector Backbone Description: Backbone Size:8221; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22260 Copy   


http://www.addgene.org/22262

Species: Homo sapiens
Genetic Insert: HRAS G12V
Vector Backbone Description: Backbone Size:8176; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22262 Copy   


http://www.addgene.org/22159

Species: Homo sapiens
Genetic Insert: hBEN
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: GFP cloned in SpeI/ClaI

Proper citation: RRID:Addgene_22159 Copy   


  • RRID:Addgene_22276

    This resource has 1+ mentions.

http://www.addgene.org/22276

Species: Arabidopsis thaliana
Genetic Insert: PIF6APB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4860; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22276 Copy   


  • RRID:Addgene_22278

    This resource has 1+ mentions.

http://www.addgene.org/22278

Species: Arabidopsis thaliana
Genetic Insert: IntersectinDHPH-20aaLinker-mYFP-PIF6APB
Vector Backbone Description: Backbone Size:4860; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22278 Copy   


  • RRID:Addgene_22271

    This resource has 1+ mentions.

http://www.addgene.org/22271

Species:
Genetic Insert: shRNA Cyclin-dependent kinase inhibitor 2A (CDKN2A)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7801; Vector Backbone:pQCXIN; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: shRNA oligo sequence is 5'-GACCGTAACTATTCGGTGCGTTGGGCAGAAGCTTGTGCTCAACGCACCGAATAGTTGCGGTCTTTTT

Proper citation: RRID:Addgene_22271 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X