Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,423 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pEGFPN1-human Dynamin 1aa
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22163 human Dynamin 1aa Homo sapiens Kanamycin PMID:11782545 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin D744N 2026-07-25 12:44:30 5
pcDNA-HA-CAML
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22284 calcium-modulating ligand Homo sapiens Ampicillin PMID:19135167 Backbone Marker:invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:31 1
pMH4-SYN-EGFP-ER
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22285 EGFP-ER mixture Ampicillin PMID:19706463 EGFP(A206K)= 925-1707 Calreticulin sgnalseq.=862-912 KDEL coding seq.=1714-1725 Backbone Size:6959; Vector Backbone:pMH4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin EGFP alanine 206 changed to Lysin 2026-07-25 12:44:31 2
pAL197
 
Resource Report
Resource Website 		RRID:Addgene_22280 p!SV40-PakGBD-mCherry Arabidopsis thaliana Ampicillin PMID:19749742 Backbone Marker:Invitrogen; Backbone Size:4864; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-07-25 12:44:31 0
pEBG-hBEN
 
Resource Report
Resource Website 		RRID:Addgene_22160 hBEN Homo sapiens Ampicillin PMID:11438732 Homologous to mouse BEN 1alpha1 isoform Backbone Size:6000; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:30 0
pAL198
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22281 p!SV40-mCherry-WaspGBD Arabidopsis thaliana Ampicillin PMID:19749742 Backbone Marker:Invitrogen; Backbone Size:5216; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-07-25 12:44:31 1
pcDNA3.1V5-His Snk/Plk2 D223N
 
Resource Report
Resource Website 		RRID:Addgene_22218 Snk/Plk2 Homo sapiens Ampicillin PMID:12897130 Human Snk/Plk2 was amplified from a human fetal brain cDNA library (Clontech) using PFU Turbo (Invitrogen) using the following primers: 5' CGC GGA TCC GCG ACC ATG GAG CTT TTG 3' and 5' CCG CTC GAG GTT ACA TCT TTG TAA GAG CAT 3'. Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1/V5-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin single amino acid substitution mutant, aspartic acid 223 to asparagine 2026-07-25 12:44:31 0
pcDNA3.1V5-His Snk/Plk2 T239A
 
Resource Report
Resource Website 		RRID:Addgene_22219 Snk/Plk2 Homo sapiens Ampicillin PMID:12897130 Human Snk/Plk2 was amplified from a human fetal brain cDNA library (Clontech) using PFU Turbo (Invitrogen) using the following primers: 5' CGC GGA TCC GCG ACC ATG GAG CTT TTG 3' and 5' CCG CTC GAG GTT ACA TCT TTG TAA GAG CAT 3'. Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1/V5-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin single amino acid substitution mutant, threonine 239 to alanine 2026-07-25 12:44:31 0
pcDNA3-HA-Tuba
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22214 Tuba Homo sapiens Ampicillin PMID:14506234 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:31 2
SCP1-CMVenh-luc
 
Resource Report
Resource Website 		RRID:Addgene_22216 SCP1 (super core promoter 1)-CMVenh luciferase Drosophila melanogaster Ampicillin PMID:17124735 Backbone Size:5500; Vector Backbone:Vector Backbone: a MODIFIED version (constructed by us) of Invit; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-07-25 12:44:31 0
OCT4 GFP puro Donor 3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22211 SA-OCT-GFP-2APuro-PA Homo sapiens Ampicillin PMID:19680244 Backbone Size:5468; Vector Backbone:N/A; Vector Types:; Bacterial Resistance:Ampicillin 2026-07-25 12:44:31 1
AAV-CAGGS-EGFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_22212 CAGGS-eGFP Homo sapiens Ampicillin PMID:19680244 This plasmid contains a ccdB gene that is non-functional. Backbone Size:7357; Vector Backbone:N/A; Vector Types:ZFN donor; Bacterial Resistance:Ampicillin 2026-07-25 12:44:31 48
TetR in pENTR1A (559-1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22265 Tetracycline repressor Kanamycin Please note that there are several sequence discrepancies between Addgene's quality control sequence and the depositor's reference sequence. These changes do not affect plasmid function. Backbone Marker:Invitrogen; Backbone Size:2386; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Yeast Expression, Worm Expression, Insect Expression; Bacterial Resistance:Kanamycin 2026-07-25 12:44:31 2
pQCXIB GFP (w301-1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22266 Enhanced Green Fluorescent Protein Ampicillin Backbone Marker:Eric Campeau; Backbone Size:6869; Vector Backbone:pQCXIB; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-07-25 12:44:31 2
pLenti CMV p16 Neo (w111-1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22260 cyclin-dependent kinase inhibitor 2A Homo sapiens Ampicillin Backbone Size:8221; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:44:31 4
pLenti CMV/TO RasV12 Puro (w119-1)
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_22262 HRAS G12V Homo sapiens Ampicillin Backbone Size:8176; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin G12V mutant 2026-07-25 12:44:31 14
pEBB-GFP-hBEN-deltaSS
 
Resource Report
Resource Website 		RRID:Addgene_22159 hBEN Homo sapiens Ampicillin PMID:11438732 GFP cloned in SpeI/ClaI Backbone Size:6000; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Deletion of amino acids 897-908 2026-07-25 12:44:30 0
pAL175
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22276 PIF6APB Arabidopsis thaliana Ampicillin PMID:19749742 Backbone Marker:Invitrogen; Backbone Size:4860; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-07-25 12:44:31 2
pAL189
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22278 IntersectinDHPH-20aaLinker-mYFP-PIF6APB Arabidopsis thaliana Ampicillin PMID:19749742 Backbone Size:4860; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-07-25 12:44:31 1
pQCXIN X2/shp16 (w415-1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22271 shRNA Cyclin-dependent kinase inhibitor 2A (CDKN2A) Ampicillin shRNA oligo sequence is 5'-GACCGTAACTATTCGGTGCGTTGGGCAGAAGCTTGTGCTCAACGCACCGAATAGTTGCGGTCTTTTT Backbone Marker:Clontech; Backbone Size:7801; Vector Backbone:pQCXIN; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin 2026-07-25 12:44:31 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join Dr. Chen Li for a Knowledge Portal Network Webinar on the dkNET Computational Core on August 6

Join NIH ODSS Data Sharing and Reuse Seminar "PanKbase: An Open, FAIR Knowledge Base of the Human Pancreas to Accelerate Diabetes Research"

Join the NIDDK-CR Webinar "Design Patterns for Reproducible Research" on July 29, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch