Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Arabidopsis thaliana
Genetic Insert: auxin-inducible degron (aid)
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_169359 Copy
Species: Arabidopsis thaliana
Genetic Insert: auxin-inducible degron (aid)
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_169354 Copy
Species: Arabidopsis thaliana
Genetic Insert: auxin-inducible degron (aid)
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_169355 Copy
Species: Arabidopsis thaliana
Genetic Insert: N-terminal portion of the CIB1 transcription factor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26350769
Proper citation: RRID:Addgene_75267 Copy
Species: Arabidopsis thaliana
Genetic Insert: CIB1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27065233
Proper citation: RRID:Addgene_75366 Copy
Species: Arabidopsis thaliana
Genetic Insert: CRY2 residues 1-498
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27065233
Proper citation: RRID:Addgene_75370 Copy
Species: Arabidopsis thaliana
Genetic Insert: CRY2 residues 1-535
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27065233
Proper citation: RRID:Addgene_75372 Copy
Species: Arabidopsis thaliana
Genetic Insert: PIAL2
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:6700; Vector Backbone:pMAL-c2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25415977
Proper citation: RRID:Addgene_67908 Copy
Species: Arabidopsis thaliana
Genetic Insert: CTG10
Vector Backbone Description: Backbone Marker:Invitrogen; life technologies Thermo Fisher Scientific; Backbone Size:4761; Vector Backbone:Gateway® pDONR™221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29632208
Proper citation: RRID:Addgene_67917 Copy
Species: Arabidopsis thaliana
Genetic Insert: PRORP3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28-b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22976545
Proper citation: RRID:Addgene_67871 Copy
Species: Arabidopsis thaliana
Genetic Insert: PHY-INTERACTING FACTOR 1 (PIF1)
Vector Backbone Description: Backbone Marker:Novagen; EMD Millipore; Backbone Size:3666; Vector Backbone:pET23b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29632208
Proper citation: RRID:Addgene_68017 Copy
Species: Arabidopsis thaliana
Genetic Insert: Promoter_AtU6-26 + sgRNA_BolC.GA4a-1
Vector Backbone Description: Vector Backbone:pICH47751 (AddGene #48002); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26616834
Comments: Target sequence: GTTTTCACTTGCGGCCGGAG
Proper citation: RRID:Addgene_68255 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtU6-26 promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68208 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtML1 promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68164 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtAct2 promoter (no UTR)
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68177 Copy
Species: Arabidopsis thaliana
Genetic Insert: 5'UTR AtAct2
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68178 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtAct2 terminator
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68191 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtHsp18.2 terminator
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68186 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtUbq3 terminator
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68192 Copy
Species: Arabidopsis thaliana
Genetic Insert: OPTX promoter
Vector Backbone Description: Backbone Marker:Calderon-Villalobos et al 2006 Plant Physiol 141:3-14 (GenBank: AY968054.1); Backbone Size:7272; Vector Backbone:pLUC Trap3 (GW); Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24206622
Proper citation: RRID:Addgene_68504 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.