Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pHIS3p:CloverGFP-Tub1+3'UTR::LEU2 Resource Report Resource Website |
RRID:Addgene_50642 | CloverGFP-Tub1 | Saccharomyces cerevisiae | Ampicillin | PMID:25711127 | Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:07 | 0 | ||
|
pHIS3p:yomWasabi-Tub1+3'UTR::LEU2 Resource Report Resource Website |
RRID:Addgene_50643 | yomWasabi-Tub1 | Saccharomyces cerevisiae | Ampicillin | PMID:25711127 | Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:07 | 0 | ||
|
pHIS3p:yomWasabi-Tub1+3'UTR::TRP1 Resource Report Resource Website |
RRID:Addgene_50649 | yomWasabi-Tub1 | Saccharomyces cerevisiae | Ampicillin | PMID:25711127 | Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:07 | 0 | ||
|
pHIS3p:Venus-Tub1+3'UTR::TRP1 Resource Report Resource Website |
RRID:Addgene_50650 | Venus-Tub1 | Saccharomyces cerevisiae | Ampicillin | PMID:25711127 | Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 0 | ||
|
pHIS3p:Venus-Tub1+3'UTR::HIS3 Resource Report Resource Website |
RRID:Addgene_50656 | Venus-Tub1 | Saccharomyces cerevisiae | Ampicillin | PMID:25711127 | Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 0 | ||
|
pHIS3p:mEos2-Tub1+3'UTR::TRP1 Resource Report Resource Website |
RRID:Addgene_50652 | mEos2-Tub1 | Saccharomyces cerevisiae | Ampicillin | PMID:25711127 | Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:07 | 0 | ||
|
pHIS3p:CloverGFP-Tub1+3'UTR::HIS3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50654 | CloverGFP-Tub1 | Saccharomyces cerevisiae | Ampicillin | PMID:25711127 | Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:07 | 1 | ||
|
IpO Resource Report Resource Website 1+ mentions |
RRID:Addgene_48233 | URA3 3' fragment | Saccharomyces cerevisiae | Ampicillin | PMID:24604451 | Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin | URA3 ORF from +216 to 80 bp downstream of the stop codon | 2026-08-15 01:15:48 | 1 | |
|
pJH104 Resource Report Resource Website |
RRID:Addgene_48262 | TEF1p 5' fragment | Saccharomyces cerevisiae | Ampicillin | PMID:24604451 | Created by 4-part ligation with XhoI/EagI cut pBluescript II SK (-). Inserts were XhoI/XbaI TEF1p, XbaI/BamHI URA3, and BamHI/EagI TEF1p. | Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin | From SK1 background. -460 to -128 relative to TEF1 ORF | 2026-08-15 01:15:48 | 0 |
|
pJH124 Resource Report Resource Website |
RRID:Addgene_48259 | URA3 3' fragment | Saccharomyces cerevisiae | Ampicillin | PMID:24604451 | pJH124 was created by cloning an XbaI/XhoI Ag TEF1 promoter fragment into the same sites of vector IpO. The cloned insert was confirmed by DNA sequencing. | Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin | URA3 ORF from +216 to 80 bp downstream of the stop codon | 2026-08-15 01:15:49 | 0 |
|
mito-BFP Resource Report Resource Website 50+ mentions |
RRID:Addgene_49151 | mitochondrial targeting signal | Saccharomyces cerevisiae | Kanamycin | PMID:21885730 | Backbone Marker:Clontech; Vector Backbone:pAcGFP1-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:56 | 59 | ||
|
pET15b-eIF4E Resource Report Resource Website |
RRID:Addgene_37228 | eIF4E | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pET15b-eIF4E-S200C Resource Report Resource Website |
RRID:Addgene_37229 | eIF4E | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | S200C | 2026-08-15 01:14:13 | 0 | |
|
pMGAHisTev5B Resource Report Resource Website |
RRID:Addgene_37221 | eIF5B | Saccharomyces cerevisiae | Kanamycin | PMID:17913637 | Vector Backbone:pSKB3; Vector Types:; Bacterial Resistance:Kanamycin | N-term truncation (contains aa 396-1002) | 2026-08-15 01:14:13 | 0 | |
|
pUC19-HHtRNA Resource Report Resource Website |
RRID:Addgene_37222 | HHtRNA | Saccharomyces cerevisiae | Ampicillin | PMID:17913637 | HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |
|
pTYB2-eIF1 Resource Report Resource Website |
RRID:Addgene_37217 | eIF1 | Saccharomyces cerevisiae | Ampicillin | PMID:17913637 | Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pTYB2-eIF5 Resource Report Resource Website |
RRID:Addgene_37219 | eIF5 | Saccharomyces cerevisiae | Ampicillin | PMID:17913637 | Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pTYB2-HCR1 Resource Report Resource Website |
RRID:Addgene_37233 | HRC1 | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pRS306:Met3p-mCherry-Tub1 Resource Report Resource Website |
RRID:Addgene_37554 | Met3p-mCherry-Tub1 | Saccharomyces cerevisiae | Ampicillin | PMID:21294277 | Backbone Size:4381; Vector Backbone:pRS306; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 | ||
|
pKT0128-RAS2 C-term Resource Report Resource Website |
RRID:Addgene_37557 | Ras2 C-term (last 9 aa) | Saccharomyces cerevisiae | Ampicillin | PMID:19755860 | Backbone Size:4749; Vector Backbone:pKT0128; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.