Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:streptomycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

228 Results - per page

Show More Columns | Download 228 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCDF RBP-FL P53
 
Resource Report
Resource Website 		RRID:Addgene_174042 P53 gene Homo sapiens Streptomycin PMID:33263541 Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-01 01:08:32 0
BJ5183 cells
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_16398 BJ5183 bacterial cells E. coli Streptomycin PMID:9482916 This is a bacterial strain - not a plasmid. Select with 30 ug/mL streptomycin. Electrocompetent BJ5183 cells are used to carry out the recombination between the shuttle vector (pShuttle, pShuttle-CMV, pAdTrack, or pAdTrack-CMV) and the adenoviral vector (pAdEasy1 or pAdEasy2). Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-01 01:07:15 4
Syn61
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_174513 Recoded E. coli strain without TCG, TCA, or TAG codons Streptomycin PMID:31092918 The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames. Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-01 01:08:37 2
Syn61Δ3(ev5)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_174514 Recoded E. coli strain without TCG, TCA, or TAG codons in the open reading frames and deleted serT, serU and prfA genes Streptomycin PMID:34083482 From the Syn61 strain (Addgene #174513), two rounds of parallel mutagenesis and dynamic selection were followed by deletion of the serT, serU and prfA genes, and a further three rounds of parallel mutagenesis and dynamic selection yielded Syn61Δ3(ev5) (Addgene #174514). Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG Genotyping for deletion of serU gene: GE1147 TACGAATGATGCCTCGCCGCAAATAAG GE1148 CCTCACGCAACGGAATAAAGGGAACTC Genotyping for deletion of serT gene: GE1215 AGCGTCAGGCTCAGCAGAAAATAGG GE1216 ACGTCCCTGTAGCAAGGCAAACCATC Genotyping for deletion of prfA gene: v13-1011 GACTAACCGCTTGATCCATGCGC v13-1012 CAAGTTGCTGACATTGTTCGTCAGTCAGC Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-01 01:08:37 2
pECO300
 
Resource Report
Resource Website 		RRID:Addgene_169766 Streptomycin PMID:32190101 Vector Backbone:pHAtC; Vector Types:Plant Expression, Plant Binary vector; Bacterial Resistance:Streptomycin 2026-08-01 01:07:57 0
MM39
 
Resource Report
Resource Website 		RRID:Addgene_42894 Streptomycin PMID:22822084 selection using 10-15 micrograms/mL strep. It is MalE deficient, which enables maltose complementation. For the assay, a particular construct is transformed into MM39 and grown on maltose minimal media to confirm proper membrane orientation and integration. Vector Backbone:genome; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-01 01:13:14 0
pCDF_TypeIC_target_sfGFP_invivo
 
Resource Report
Resource Website 		RRID:Addgene_196399 type IC dsDNA target Synthetic Streptomycin PMID:36805026 Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-01 01:26:12 0
pS44i8GH-2
 
Resource Report
Resource Website 		RRID:Addgene_207526 oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b→msfGFP Streptomycin PMID:38180826 Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin 2026-08-01 01:27:02 0
pS44i8GM
 
Resource Report
Resource Website 		RRID:Addgene_207527 oriV(pRO1600/ColE1), xylS, Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP Streptomycin PMID:38180826 Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin 2026-08-01 01:27:02 0
pEditA-RY
 
Resource Report
Resource Website 		RRID:Addgene_207533 xylS (cured of BsaI-sites), Pm→ABE:SpRY, PEM7→non-specific sgRNA Streptomycin PMID:38180826 Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin 2026-08-01 01:27:02 0
pEditC-RY
 
Resource Report
Resource Website 		RRID:Addgene_207534 xylS (cured of BsaI-sites), Pm→CBE:SpRY, PEM7→non-specific sgRNA Streptomycin PMID:38180826 Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin 2026-08-01 01:27:02 0
pEditC
 
Resource Report
Resource Website 		RRID:Addgene_207532 xylS (cured of BsaI-sites), Pm→CBE:SpnCas9, PEM7→non-specific sgRNA Streptomycin PMID:38180826 Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin 2026-08-01 01:27:02 0
pSEVA43-GG
 
Resource Report
Resource Website 		RRID:Addgene_208014 msfGFP Streptomycin PMID:37975669 Please visit https://doi.org/10.1101/2023.06.29.547033 for bioRxiv preprint. Backbone Marker:SEVA collection; Backbone Size:3182; Vector Backbone:pSEVA231; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-01 01:27:02 0
pIVM_26
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_204501 EloB (1-104) and EloC (17-112) Homo sapiens Streptomycin PMID:28591624 Gadd MS, Testa A, Lucas X, Chan KH, Chen W, Lamont DJ, Zengerle M, Ciulli A. Structural basis of PROTAC cooperative recognition for selective protein degradation. Nat Chem Biol. 2017 May;13(5):514-521. doi: 10.1038/nchembio.2329. Epub 2017 Mar 13. PMID: 28288108; PMCID: PMC5392356. Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDF-1b DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 0 2026-08-01 01:26:21 1
NCH1exp
 
Resource Report
Resource Website 		RRID:Addgene_131017 NCH1 Zea mays (maize) Streptomycin PMID:33679862 Backbone Size:11546; Vector Backbone:pH7WG2; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin 2026-08-01 01:21:18 0
Syn61Δ3(ev5) ΔrecA (ev1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_189857 ΔrecA Synthetic Streptomycin PMID:36922599 Details of construction, use, and characterization are available in Nyerges A, Vinke S, Flynn R, Owen SV, Rand EA, Budnik B, Keen E, Narasimhan K, Marchand JA, Baas-Thomas M, Liu M, Chen K, Chiappino-Pepe A, Hu F, Baym M, Church GM (2022) Swapped genetic code blocks viral infections and gene transfer, https://doi.org/10.1101/2022.07.08.499367 https://www.biorxiv.org/content/10.1101/2022.07.08.499367v1.full Vector Backbone:N.A.; Vector Types:; Bacterial Resistance:Streptomycin ΔrecA 2026-08-01 01:23:34 1
HE_150
 
Resource Report
Resource Website 		RRID:Addgene_201051 n/a Streptomycin This strain has 1059 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110015 and the accompanying paper for more details. Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-01 01:25:04 0
HE_100
 
Resource Report
Resource Website 		RRID:Addgene_201050 n/a Streptomycin This strain has 797 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110016 and the accompanying paper for more details. Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-01 01:25:05 0
pAF-HdrB3
 
Resource Report
Resource Website 		RRID:Addgene_184908 Cas9-sgRNA-homology arms Synthetic Streptomycin PMID:37556825 Please visit https://www.biorxiv.org/content/10.1101/2022.03.14.484339v1 for bioRxiv preprint. Vector Backbone:pJRD215; Vector Types:Bacterial Expression, CRISPR, broad-host-range; Bacterial Resistance:Streptomycin 2026-08-01 01:22:10 0
pREDawn-StrR-MCS
 
Resource Report
Resource Website 		RRID:Addgene_188979 Streptomycin PMID:35998606 Please note that Addgene's NGS found a 65bp insertion in the ori region as compared to the Depositor's sequence. The depositor has confirmed that the plasmid functions as described in the associated publication. Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-01 01:22:23 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Join Dr. Chen Li for a Knowledge Portal Network Webinar on the dkNET Computational Core on August 6

Join NIH ODSS Data Sharing and Reuse Seminar "PanKbase: An Open, FAIR Knowledge Base of the Human Pancreas to Accelerate Diabetes Research"

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch