Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: ABL2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40419795
Proper citation: RRID:Addgene_215467 Copy
Species: Other
Genetic Insert: Scream2
Vector Backbone Description: Backbone Marker:Sylvestre Marillonnet; Backbone Size:5201; Vector Backbone:pAGM8031; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39943924
Proper citation: RRID:Addgene_215191 Copy
Species: Homo sapiens
Genetic Insert: huH3
Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:41123210
Proper citation: RRID:Addgene_197272 Copy
Species: Acetobacter aceti 1023
Genetic Insert: hypothetical protein in purSQL operon
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Comments: pCloDF13 replicon
Contains additional (repeated?) sequence in 3' UTR of cassette 1.
Proper citation: RRID:Addgene_72522 Copy
Species: Acetobacter aceti 1023
Genetic Insert: N5-carboxyaminoimidazole ribonucleotide mutase
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_72453 Copy
Species: Acetobacter aceti 1023
Genetic Insert: N5-carboxyaminoimidazole ribonucleotide mutase
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_72451 Copy
Species: Homo sapiens
Genetic Insert: EloB (1-104) and EloC (17-112)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDF-1b DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28591624
Comments: Gadd MS, Testa A, Lucas X, Chan KH, Chen W, Lamont DJ, Zengerle M, Ciulli A. Structural basis of PROTAC cooperative recognition for selective protein degradation. Nat Chem Biol. 2017 May;13(5):514-521. doi: 10.1038/nchembio.2329. Epub 2017 Mar 13. PMID: 28288108; PMCID: PMC5392356.
Proper citation: RRID:Addgene_204501 Copy
Genetic Insert: n/a
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Comments: This strain has 1059 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110015 and the accompanying paper for more details.
Proper citation: RRID:Addgene_201051 Copy
Genetic Insert: n/a
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Comments: This strain has 797 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110016 and the accompanying paper for more details.
Proper citation: RRID:Addgene_201050 Copy
Species: Synthetic
Genetic Insert: type IC dsDNA target
Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36805026
Proper citation: RRID:Addgene_196399 Copy
Species: E. coli
Genetic Insert: PBM3R1-YFP
Vector Backbone Description: Backbone Marker:Alec Nielsen; Backbone Size:3359; Vector Backbone:pAN4020; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27034378
Proper citation: RRID:Addgene_74701 Copy
Species: E. coli
Genetic Insert: PPhlF-PBetI-YFP
Vector Backbone Description: Backbone Marker:Alec Nielsen; Backbone Size:3359; Vector Backbone:pAN4020; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27034378
Proper citation: RRID:Addgene_74703 Copy
Genetic Insert: pGH3.17::SMT2-FLAG
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170844 Copy
Genetic Insert: pUBQ10::SMT2-FLAG::tOCS
Vector Backbone Description: Vector Backbone:pFP100; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170842 Copy
Genetic Insert: pFRO6::SMT2-FLAG
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please note that the Addgene verified sequence differs from the depositor reference sequence linked in the supplemental documents section. These differences did not impact plasmid function. The primers 5' - ATCCAAGCTCAAGCTAAGCTcgatgctctcaaggccaa and 3' -TATCTCATTAAAGCAGGATCCTCACTTGTCATCGTCGTCCTTGTAATCAGAACTCTCCTCCGGT were previously used, although the 5' primer differs slightly from the Addgene verified sequence.
Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170843 Copy
Genetic Insert: GH3.17p
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170841 Copy
Species: Synthetic
Genetic Insert: ΔrecA
Vector Backbone Description: Vector Backbone:N.A.; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36922599
Comments: Details of construction, use, and characterization are available in
Nyerges A, Vinke S, Flynn R, Owen SV, Rand EA, Budnik B, Keen E, Narasimhan K, Marchand JA, Baas-Thomas M, Liu M, Chen K, Chiappino-Pepe A, Hu F, Baym M, Church GM (2022) Swapped genetic code blocks viral infections and gene transfer, https://doi.org/10.1101/2022.07.08.499367
https://www.biorxiv.org/content/10.1101/2022.07.08.499367v1.full
Proper citation: RRID:Addgene_189857 Copy
Species: Escherichia coli
Genetic Insert: phosphoglycerate kinase
Vector Backbone Description: Backbone Size:3810; Vector Backbone:pCDM4; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23361000
Proper citation: RRID:Addgene_49808 Copy
Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28174228
Proper citation: RRID:Addgene_82718 Copy
Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28174228
Proper citation: RRID:Addgene_82719 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
