Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 8 showing 141 ~ 160 out of 4,486 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.addgene.org/50642

Species: Saccharomyces cerevisiae
Genetic Insert: CloverGFP-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127

Proper citation: RRID:Addgene_50642 Copy   

http://www.addgene.org/50643

Species: Saccharomyces cerevisiae
Genetic Insert: yomWasabi-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127

Proper citation: RRID:Addgene_50643 Copy   

http://www.addgene.org/50649

Species: Saccharomyces cerevisiae
Genetic Insert: yomWasabi-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127

Proper citation: RRID:Addgene_50649 Copy   

http://www.addgene.org/50650

Species: Saccharomyces cerevisiae
Genetic Insert: Venus-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127

Proper citation: RRID:Addgene_50650 Copy   

http://www.addgene.org/50656

Species: Saccharomyces cerevisiae
Genetic Insert: Venus-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127

Proper citation: RRID:Addgene_50656 Copy   

http://www.addgene.org/50652

Species: Saccharomyces cerevisiae
Genetic Insert: mEos2-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127

Proper citation: RRID:Addgene_50652 Copy   

http://www.addgene.org/50654

Species: Saccharomyces cerevisiae
Genetic Insert: CloverGFP-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127

Proper citation: RRID:Addgene_50654 Copy   

    • RRID:Addgene_48233

    This resource has 1+ mentions.

http://www.addgene.org/48233

Species: Saccharomyces cerevisiae
Genetic Insert: URA3 3' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451

Proper citation: RRID:Addgene_48233 Copy   

    • RRID:Addgene_48262

http://www.addgene.org/48262

Species: Saccharomyces cerevisiae
Genetic Insert: TEF1p 5' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Comments: Created by 4-part ligation with XhoI/EagI cut pBluescript II SK (-). Inserts were XhoI/XbaI TEF1p, XbaI/BamHI URA3, and BamHI/EagI TEF1p.

Proper citation: RRID:Addgene_48262 Copy   

    • RRID:Addgene_48259

http://www.addgene.org/48259

Species: Saccharomyces cerevisiae
Genetic Insert: URA3 3' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Comments: pJH124 was created by cloning an XbaI/XhoI Ag TEF1 promoter fragment into the same sites of vector IpO. The cloned insert was confirmed by DNA sequencing.

Proper citation: RRID:Addgene_48259 Copy   

    • RRID:Addgene_49151

    This resource has 50+ mentions.

http://www.addgene.org/49151

Species: Saccharomyces cerevisiae
Genetic Insert: mitochondrial targeting signal
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pAcGFP1-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21885730

Proper citation: RRID:Addgene_49151 Copy   

    • RRID:Addgene_37228

http://www.addgene.org/37228

Species: Saccharomyces cerevisiae
Genetic Insert: eIF4E
Vector Backbone Description: Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040

Proper citation: RRID:Addgene_37228 Copy   

    • RRID:Addgene_37229

http://www.addgene.org/37229

Species: Saccharomyces cerevisiae
Genetic Insert: eIF4E
Vector Backbone Description: Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040

Proper citation: RRID:Addgene_37229 Copy   

    • RRID:Addgene_37221

http://www.addgene.org/37221

Species: Saccharomyces cerevisiae
Genetic Insert: eIF5B
Vector Backbone Description: Vector Backbone:pSKB3; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17913637

Proper citation: RRID:Addgene_37221 Copy   

    • RRID:Addgene_37222

http://www.addgene.org/37222

Species: Saccharomyces cerevisiae
Genetic Insert: HHtRNA
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637
Comments: HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG

Proper citation: RRID:Addgene_37222 Copy   

    • RRID:Addgene_37217

http://www.addgene.org/37217

Species: Saccharomyces cerevisiae
Genetic Insert: eIF1
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637

Proper citation: RRID:Addgene_37217 Copy   

    • RRID:Addgene_37219

http://www.addgene.org/37219

Species: Saccharomyces cerevisiae
Genetic Insert: eIF5
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637

Proper citation: RRID:Addgene_37219 Copy   

    • RRID:Addgene_37233

http://www.addgene.org/37233

Species: Saccharomyces cerevisiae
Genetic Insert: HRC1
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040

Proper citation: RRID:Addgene_37233 Copy   

http://www.addgene.org/37554

Species: Saccharomyces cerevisiae
Genetic Insert: Met3p-mCherry-Tub1
Vector Backbone Description: Backbone Size:4381; Vector Backbone:pRS306; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21294277

Proper citation: RRID:Addgene_37554 Copy   

    • RRID:Addgene_37557

http://www.addgene.org/37557

Species: Saccharomyces cerevisiae
Genetic Insert: Ras2 C-term (last 9 aa)
Vector Backbone Description: Backbone Size:4749; Vector Backbone:pKT0128; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19755860

Proper citation: RRID:Addgene_37557 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Join Dr. Chen Li for a Knowledge Portal Network Webinar on the dkNET Computational Core on August 6

Join NIH ODSS Data Sharing and Reuse Seminar "PanKbase: An Open, FAIR Knowledge Base of the Human Pancreas to Accelerate Diabetes Research"

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch