Plasmids   Select Another Resource Report Type

http://www.addgene.org/174042

Species: Homo sapiens
Genetic Insert: P53 gene
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:33263541

Proper citation: RRID:Addgene_174042 Copy   

•   Source: Addgene

http://www.addgene.org/16398

Species: E. coli
Genetic Insert: BJ5183 bacterial cells
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:9482916
Comments: This is a bacterial strain - not a plasmid. Select with 30 ug/mL streptomycin. Electrocompetent BJ5183 cells are used to carry out the recombination between the shuttle vector (pShuttle, pShuttle-CMV, pAdTrack, or pAdTrack-CMV) and the adenoviral vector (pAdEasy1 or pAdEasy2).

Proper citation: RRID:Addgene_16398 Copy   

•   Source: Addgene

http://www.addgene.org/174513

Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31092918
Comments: The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames. Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG

Proper citation: RRID:Addgene_174513 Copy   

•   Source: Addgene

http://www.addgene.org/174514

Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons in the open reading frames and deleted serT, serU and prfA genes
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34083482
Comments: From the Syn61 strain (Addgene #174513), two rounds of parallel mutagenesis and dynamic selection were followed by deletion of the serT, serU and prfA genes, and a further three rounds of parallel mutagenesis and dynamic selection yielded Syn61Δ3(ev5) (Addgene #174514). Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG Genotyping for deletion of serU gene: GE1147 TACGAATGATGCCTCGCCGCAAATAAG GE1148 CCTCACGCAACGGAATAAAGGGAACTC Genotyping for deletion of serT gene: GE1215 AGCGTCAGGCTCAGCAGAAAATAGG GE1216 ACGTCCCTGTAGCAAGGCAAACCATC Genotyping for deletion of prfA gene: v13-1011 GACTAACCGCTTGATCCATGCGC v13-1012 CAAGTTGCTGACATTGTTCGTCAGTCAGC

Proper citation: RRID:Addgene_174514 Copy   

•   Source: Addgene

http://www.addgene.org/169766

Vector Backbone Description: Vector Backbone:pHAtC; Vector Types:Plant Expression, Plant Binary vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:32190101

Proper citation: RRID:Addgene_169766 Copy   

•   Source: Addgene

http://www.addgene.org/42894

Vector Backbone Description: Vector Backbone:genome; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:22822084
Comments: selection using 10-15 micrograms/mL strep. It is MalE deficient, which enables maltose complementation. For the assay, a particular construct is transformed into MM39 and grown on maltose minimal media to confirm proper membrane orientation and integration.

Proper citation: RRID:Addgene_42894 Copy   

•   Source: Addgene

http://www.addgene.org/196399

Species: Synthetic
Genetic Insert: type IC dsDNA target
Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36805026

Proper citation: RRID:Addgene_196399 Copy   

•   Source: Addgene

http://www.addgene.org/207526

Genetic Insert: oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b→msfGFP
Vector Backbone Description: Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:38180826

Proper citation: RRID:Addgene_207526 Copy   

•   Source: Addgene

http://www.addgene.org/207527

Genetic Insert: oriV(pRO1600/ColE1), xylS, Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP
Vector Backbone Description: Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:38180826

Proper citation: RRID:Addgene_207527 Copy   

•   Source: Addgene

http://www.addgene.org/207533

Genetic Insert: xylS (cured of BsaI-sites), Pm→ABE:SpRY, PEM7→non-specific sgRNA
Vector Backbone Description: Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:38180826

Proper citation: RRID:Addgene_207533 Copy   

•   Source: Addgene

http://www.addgene.org/207534

Genetic Insert: xylS (cured of BsaI-sites), Pm→CBE:SpRY, PEM7→non-specific sgRNA
Vector Backbone Description: Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:38180826

Proper citation: RRID:Addgene_207534 Copy   

•   Source: Addgene

http://www.addgene.org/207532

Genetic Insert: xylS (cured of BsaI-sites), Pm→CBE:SpnCas9, PEM7→non-specific sgRNA
Vector Backbone Description: Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:38180826

Proper citation: RRID:Addgene_207532 Copy   

•   Source: Addgene

http://www.addgene.org/208014

Genetic Insert: msfGFP
Vector Backbone Description: Backbone Marker:SEVA collection; Backbone Size:3182; Vector Backbone:pSEVA231; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37975669
Comments: Please visit https://doi.org/10.1101/2023.06.29.547033 for bioRxiv preprint.

Proper citation: RRID:Addgene_208014 Copy   

•   Source: Addgene

http://www.addgene.org/204501

Species: Homo sapiens
Genetic Insert: EloB (1-104) and EloC (17-112)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDF-1b DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28591624
Comments: Gadd MS, Testa A, Lucas X, Chan KH, Chen W, Lamont DJ, Zengerle M, Ciulli A. Structural basis of PROTAC cooperative recognition for selective protein degradation. Nat Chem Biol. 2017 May;13(5):514-521. doi: 10.1038/nchembio.2329. Epub 2017 Mar 13. PMID: 28288108; PMCID: PMC5392356.

Proper citation: RRID:Addgene_204501 Copy   

•   Source: Addgene

http://www.addgene.org/131017

Species: Zea mays (maize)
Genetic Insert: NCH1
Vector Backbone Description: Backbone Size:11546; Vector Backbone:pH7WG2; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:33679862

Proper citation: RRID:Addgene_131017 Copy   

•   Source: Addgene

http://www.addgene.org/189857

Species: Synthetic
Genetic Insert: ΔrecA
Vector Backbone Description: Vector Backbone:N.A.; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36922599
Comments: Details of construction, use, and characterization are available in Nyerges A, Vinke S, Flynn R, Owen SV, Rand EA, Budnik B, Keen E, Narasimhan K, Marchand JA, Baas-Thomas M, Liu M, Chen K, Chiappino-Pepe A, Hu F, Baym M, Church GM (2022) Swapped genetic code blocks viral infections and gene transfer, https://doi.org/10.1101/2022.07.08.499367 https://www.biorxiv.org/content/10.1101/2022.07.08.499367v1.full

Proper citation: RRID:Addgene_189857 Copy   

•   Source: Addgene

http://www.addgene.org/201051

Genetic Insert: n/a
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Comments: This strain has 1059 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110015 and the accompanying paper for more details.

Proper citation: RRID:Addgene_201051 Copy   

•   Source: Addgene

http://www.addgene.org/201050

Genetic Insert: n/a
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Comments: This strain has 797 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110016 and the accompanying paper for more details.

Proper citation: RRID:Addgene_201050 Copy   

•   Source: Addgene

http://www.addgene.org/184908

Species: Synthetic
Genetic Insert: Cas9-sgRNA-homology arms
Vector Backbone Description: Vector Backbone:pJRD215; Vector Types:Bacterial Expression, CRISPR, broad-host-range; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37556825
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.14.484339v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_184908 Copy   

•   Source: Addgene

http://www.addgene.org/188979

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:35998606
Comments: Please note that Addgene's NGS found a 65bp insertion in the ori region as compared to the Depositor's sequence. The depositor has confirmed that the plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_188979 Copy   

•   Source: Addgene