Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,423 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pWJPrP43
 
Resource Report
Resource Website 		RRID:Addgene_22112 PrP ki-3F4-FFI TC Mus musculus Ampicillin PMID:19709627 Backbone Size:2900; Vector Backbone:pBTIIKS(+); Vector Types:Mouse Targeting, construction of targeting vector; Bacterial Resistance:Ampicillin 3F4 epitope and FFI related D177N mutation 2026-07-25 12:44:30 0
pGEX-6P1-Ataxin3Q22-C14A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22113 Ataxin 3 Homo sapiens Ampicillin PMID:18599482 Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin C14A 2026-07-25 12:44:30 1
pTRE-TIGHT-EGFP-donor fw copy
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22074 TETO-eGFP Homo sapiens Ampicillin PMID:19680244 Backbone Size:6885; Vector Backbone:N/A; Vector Types:; Bacterial Resistance:Ampicillin 2026-07-25 12:44:29 4
AAVS1 SA-2A-puro-pA donor
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_22075 SA-Puro Homo sapiens Ampicillin PMID:19680244 Please note that this plasmid contains a non-functional ccdB gene. The use of ccdB survival cells may be needed when subcloning or modifying this vector if the number of transformants is low. Backbone Size:5890; Vector Backbone:N/A; Vector Types:ZFN donor; Bacterial Resistance:Ampicillin 2026-07-25 12:44:30 20
pEB602
 
Resource Report
Resource Website 		RRID:Addgene_22071 Ampicillin PMID:16294310 Backbone Size:4629; Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:29 0
HA-VHL Y98H-pRc/CMV
 
Resource Report
Resource Website 		RRID:Addgene_22044 von Hippel-Lindau tumor suppressor (VHL) Homo sapiens Ampicillin PMID:9651579 Backbone Marker:Invitrogen; Backbone Size:5448; Vector Backbone:pRc/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin point mutant, converting aa 98 from Tyrosine to Histidine (Y98H) 2026-07-25 12:44:29 0
pAL120-modified
 
Resource Report
Resource Website 		RRID:Addgene_22057 mCMV expression cassette Ampicillin PMID:18287240 Backbone Size:6673; Vector Backbone:pAL119; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin 2026-07-25 12:44:29 0
Fubi-ChR2-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22051 ChR2-GFP C. reinhardtii Ampicillin PMID:16116447 PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER NOVEL REAGENTS IN THIS LINE. Backbone Marker:Lois/Baltimore; Backbone Size:9115; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin N/A 2026-07-25 12:44:29 4
pAL120-TK
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22053 HSV Type 1 thymidine kinase Herpes Simplex Type 1 Ampicillin PMID:18287240 Backbone Size:8294; Vector Backbone:pAL120; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin 2026-07-25 12:44:29 1
pSTK120-mCMV-TK
 
Resource Report
Resource Website 		RRID:Addgene_22054 mCMV-TK-pA expression cassette Herpes Simplex Type 1 Ampicillin PMID:18287240 Backbone Size:28750; Vector Backbone:pSTK120; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin 2026-07-25 12:44:29 0
pEBB-II-I-GFP gamma isoform
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22148 TFII-I Homo sapiens Ampicillin PMID:10854432 The internal restriction sites may not be correct Backbone Size:6000; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:30 1
ClpP-his
 
Resource Report
Resource Website 		RRID:Addgene_22144 ClpP-His6 E. Coli Ampicillin PMID:16237435 NGS results indicate S2P in ClpP Backbone Marker:Qiagen; Backbone Size:3426; Vector Backbone:pQE70; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin C-terminal His tag 2026-07-25 12:44:30 0
pEGFP-C1-A20
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_22141 A20 Homo sapiens Kanamycin PMID:18329387 Backbone Marker:clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-07-25 12:44:30 10
pAlbumin
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22037 partial sequence of human albumine Homo sapiens Ampicillin Backbone Size:7400; Vector Backbone:pRRL.SIN.cPPT.PGK.GFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:44:29 8
pEBB-GFP-hBEN-deltaNLS3
 
Resource Report
Resource Website 		RRID:Addgene_22158 hBEN Homo sapiens Ampicillin PMID:11438732 GFP cloned in SpeI/ClaI Backbone Size:6000; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Deletion of amino acids 883-889 2026-07-25 12:44:30 0
pRRL_H1shLacZ_PGK_eGFP_Teto
 
Resource Report
Resource Website 		RRID:Addgene_22038 shlacZ Ampicillin shLacZ oligo sequence is: 5'-aaaaacgactacacaaatcagcgatttctcttgaaaatcgctgatttgtgtgtcg Backbone Size:7700; Vector Backbone:pRRL.SIN.cPPT.PGK.GFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:44:29 0
pBabe-TetCMV-puro-mVenus-LOV
 
Resource Report
Resource Website 		RRID:Addgene_22033 mVenus-LOV Avena sativa (oat) Ampicillin PMID:19693014 Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Backbone Size:6000; Vector Backbone:pBabe-TetCMV-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Insert length based on Venus (720bp) + LOV (450bp) 2026-07-25 12:44:29 0
pEBG-TFII-I alpha
 
Resource Report
Resource Website 		RRID:Addgene_22154 TFII-I Homo sapiens Ampicillin PMID:10854432 Restriction sites may not be correct. Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:30 0
pBabe-TetCMV-puro-mVenus-PA-Rac1-C450M
 
Resource Report
Resource Website 		RRID:Addgene_22034 mVenus-PA-Rac1-C450M Homo sapiens Ampicillin PMID:19693014 Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt. Backbone Size:6000; Vector Backbone:pBabe-TetCMV-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin The LOV domain contains the mutation C450M.Rac1 starts at I4 and contains mutations Q61L, E91H and N92H. 2026-07-25 12:44:29 0
pCMVR8.74
 
Resource Report
Resource Website
100+ mentions 		RRID:Addgene_22036 gag pol tat rev HIV-1 Ampicillin Backbone Size:4661; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:29 239

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join Dr. Chen Li for a Knowledge Portal Network Webinar on the dkNET Computational Core on August 6

Join NIH ODSS Data Sharing and Reuse Seminar "PanKbase: An Open, FAIR Knowledge Base of the Human Pancreas to Accelerate Diabetes Research"

Join the NIDDK-CR Webinar "Design Patterns for Reproducible Research" on July 29, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch