Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Ataxin 3
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18599482
Proper citation: RRID:Addgene_22117 Copy
Species: Mus musculus
Genetic Insert: PrP genomic vector with cloning sites
Vector Backbone Description: Backbone Size:8000; Vector Backbone:pBTIIKS(+); Vector Types:construction of targeting vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19709627
Proper citation: RRID:Addgene_22110 Copy
Species: Mus musculus
Genetic Insert: PrP ki-3F4-FFI TC
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pBTIIKS(+); Vector Types:Mouse Targeting, construction of targeting vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19709627
Proper citation: RRID:Addgene_22112 Copy
Species: Homo sapiens
Genetic Insert: Ataxin 3
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18599482
Proper citation: RRID:Addgene_22113 Copy
Species: Homo sapiens
Genetic Insert: TETO-eGFP
Vector Backbone Description: Backbone Size:6885; Vector Backbone:N/A; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19680244
Proper citation: RRID:Addgene_22074 Copy
Species: Homo sapiens
Genetic Insert: SA-Puro
Vector Backbone Description: Backbone Size:5890; Vector Backbone:N/A; Vector Types:ZFN donor; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19680244
Comments: Please note that this plasmid contains a non-functional ccdB gene. The use of ccdB survival cells may be needed when subcloning or modifying this vector if the number of transformants is low.
Proper citation: RRID:Addgene_22075 Copy
Vector Backbone Description: Backbone Size:4629; Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16294310
Proper citation: RRID:Addgene_22071 Copy
Species: Homo sapiens
Genetic Insert: von Hippel-Lindau tumor suppressor (VHL)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5448; Vector Backbone:pRc/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9651579
Proper citation: RRID:Addgene_22044 Copy
Genetic Insert: mCMV expression cassette
Vector Backbone Description: Backbone Size:6673; Vector Backbone:pAL119; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18287240
Proper citation: RRID:Addgene_22057 Copy
Species: C. reinhardtii
Genetic Insert: ChR2-GFP
Vector Backbone Description: Backbone Marker:Lois/Baltimore; Backbone Size:9115; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16116447
Comments: PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER NOVEL REAGENTS IN THIS LINE.
Proper citation: RRID:Addgene_22051 Copy
Species: Herpes Simplex Type 1
Genetic Insert: HSV Type 1 thymidine kinase
Vector Backbone Description: Backbone Size:8294; Vector Backbone:pAL120; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18287240
Proper citation: RRID:Addgene_22053 Copy
Species: Herpes Simplex Type 1
Genetic Insert: mCMV-TK-pA expression cassette
Vector Backbone Description: Backbone Size:28750; Vector Backbone:pSTK120; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18287240
Proper citation: RRID:Addgene_22054 Copy
Species: Homo sapiens
Genetic Insert: TFII-I
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10854432
Comments: The internal restriction sites may not be correct
Proper citation: RRID:Addgene_22148 Copy
Species: E. Coli
Genetic Insert: ClpP-His6
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:3426; Vector Backbone:pQE70; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16237435
Comments: NGS results indicate S2P in ClpP
Proper citation: RRID:Addgene_22144 Copy
Species: Homo sapiens
Genetic Insert: A20
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18329387
Proper citation: RRID:Addgene_22141 Copy
Species: Homo sapiens
Genetic Insert: partial sequence of human albumine
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pRRL.SIN.cPPT.PGK.GFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_22037 Copy
Species: Homo sapiens
Genetic Insert: hBEN
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11438732
Comments: GFP cloned in SpeI/ClaI
Proper citation: RRID:Addgene_22158 Copy
Genetic Insert: shlacZ
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pRRL.SIN.cPPT.PGK.GFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Comments: shLacZ oligo sequence is: 5'-aaaaacgactacacaaatcagcgatttctcttgaaaatcgctgatttgtgtgtcg
Proper citation: RRID:Addgene_22038 Copy
Species: Avena sativa (oat)
Genetic Insert: mVenus-LOV
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pBabe-TetCMV-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19693014
Comments: Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments!
Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html
Proper citation: RRID:Addgene_22033 Copy
Species: Homo sapiens
Genetic Insert: TFII-I
Vector Backbone Description: Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10854432
Comments: Restriction sites may not be correct.
Proper citation: RRID:Addgene_22154 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
