Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:arabidopsis thaliana (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,244 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pABD933
 
Resource Report
Resource Website 		RRID:Addgene_67917 CTG10 Arabidopsis thaliana Kanamycin PMID:29632208 Backbone Marker:Invitrogen; life technologies Thermo Fisher Scientific; Backbone Size:4761; Vector Backbone:Gateway® pDONR™221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:18:39 0
pET28-At_PRORP3-His
 
Resource Report
Resource Website 		RRID:Addgene_67871 PRORP3 Arabidopsis thaliana Kanamycin PMID:22976545 Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28-b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:43 0
pABD1275
 
Resource Report
Resource Website 		RRID:Addgene_68017 PHY-INTERACTING FACTOR 1 (PIF1) Arabidopsis thaliana Ampicillin PMID:29632208 Backbone Marker:Novagen; EMD Millipore; Backbone Size:3666; Vector Backbone:pET23b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Codon Optimized for bacterial expression (GenScript) 2026-08-15 01:18:40 0
pICSL11061
 
Resource Report
Resource Website 		RRID:Addgene_68255 Promoter_AtU6-26 + sgRNA_BolC.GA4a-1 Arabidopsis thaliana Ampicillin PMID:26616834 Target sequence: GTTTTCACTTGCGGCCGGAG Vector Backbone:pICH47751 (AddGene #48002); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:18:41 0
pU6-26 (GB1001)
 
Resource Report
Resource Website 		RRID:Addgene_68208 AtU6-26 promoter Arabidopsis thaliana Ampicillin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin BsaI and BsmBI sites removed 2026-08-15 01:18:41 0
pPML1 (GB0045)
 
Resource Report
Resource Website 		RRID:Addgene_68164 AtML1 promoter Arabidopsis thaliana Ampicillin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin BsaI and BsmBI sites removed 2026-08-15 01:18:41 0
pPAct2noUTR (GB0192)
 
Resource Report
Resource Website 		RRID:Addgene_68177 AtAct2 promoter (no UTR) Arabidopsis thaliana Ampicillin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin BsaI and BsmBI sites removed 2026-08-15 01:18:41 0
p5'UTRAct2 (GB0193)
 
Resource Report
Resource Website 		RRID:Addgene_68178 5'UTR AtAct2 Arabidopsis thaliana Ampicillin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin BsaI and BsmBI sites removed 2026-08-15 01:18:45 0
pTAct2 (GB0210)
 
Resource Report
Resource Website 		RRID:Addgene_68191 AtAct2 terminator Arabidopsis thaliana Ampicillin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin BsaI and BsmBI sites removed 2026-08-15 01:18:45 0
pTHsp18.2 (GB0035)
 
Resource Report
Resource Website 		RRID:Addgene_68186 AtHsp18.2 terminator Arabidopsis thaliana Ampicillin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin BsaI and BsmBI sites removed 2026-08-15 01:18:41 0
pTAtUbq3 (GB0219)
 
Resource Report
Resource Website 		RRID:Addgene_68192 AtUbq3 terminator Arabidopsis thaliana Ampicillin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin BsaI and BsmBI sites removed 2026-08-15 01:18:41 0
pOPTXLUC
 
Resource Report
Resource Website 		RRID:Addgene_68504 OPTX promoter Arabidopsis thaliana Kanamycin PMID:24206622 Backbone Marker:Calderon-Villalobos et al 2006 Plant Physiol 141:3-14 (GenBank: AY968054.1); Backbone Size:7272; Vector Backbone:pLUC Trap3 (GW); Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:49 0
pETM6-At4CL-CmCHS-MsCHI
 
Resource Report
Resource Website 		RRID:Addgene_73394 At4CL Arabidopsis thaliana Ampicillin PMID:26860871 Backbone Marker:Koffas Lab, Addgene Plasmid #49795; Backbone Size:5203; Vector Backbone:pETM6; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:19:28 0
pETM6-At4CL-PhCHS-MsCHI
 
Resource Report
Resource Website 		RRID:Addgene_73392 At4CL Arabidopsis thaliana Ampicillin PMID:26860871 Backbone Marker:Koffas Lab, Addgene Plasmid #49795; Backbone Size:5203; Vector Backbone:pETM6; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:19:28 0
PhyB-mCherry-Htb2
 
Resource Report
Resource Website 		RRID:Addgene_51569 PhyB Arabidopsis thaliana Ampicillin PMID:23761071 There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene. Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 1-908aa only 2026-08-15 01:16:15 0
PhyB-mCherry-CAAX
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51567 PhyB Arabidopsis thaliana Ampicillin PMID:23761071 There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene. Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 1-908aa only 2026-08-15 01:16:19 2
PhyB-mCherry-PEX3
 
Resource Report
Resource Website 		RRID:Addgene_51572 PhyB Arabidopsis thaliana Ampicillin PMID:23761071 There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene. Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 1-908aa only 2026-08-15 01:16:15 0
PhyB-mCherry-SNF7
 
Resource Report
Resource Website 		RRID:Addgene_51574 PhyB Arabidopsis thaliana Ampicillin PMID:23761071 There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene. Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 1-908aa only 2026-08-15 01:16:19 0
PhyB-mCherry-MYO1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51570 PhyB Arabidopsis thaliana Ampicillin PMID:23761071 There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene. Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 1-908aa only 2026-08-15 01:16:19 1
PhyB-mCherry-SIK1
 
Resource Report
Resource Website 		RRID:Addgene_51577 PhyB Arabidopsis thaliana Ampicillin PMID:23761071 There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene. Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 1-908aa only 2026-08-15 01:16:15 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch