Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
IRE1b(K536A).9E10.pCDNA3 Resource Report Resource Website |
RRID:Addgene_21881 | IRE1b | Mus musculus | Ampicillin | Addgene sequencing results show an additional mutation in the coding region, causing L850P substitution in the amino acid sequence. Mouse IRE1b, K536A, 9E10-tagged at C-term, assembled from lambda-phage clones 37 and 26, in pCDNA3. The K->A mutation introduces a second MSc1 site into the plasmid at position 2578. | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | K536A | 2026-07-25 12:44:28 | 0 | |
|
boP58-pBabe.puro(notag) Resource Report Resource Website |
RRID:Addgene_21885 | P58 | Ampicillin | PMID:16923392 | Addgene sequencing results show there is no HA tag in this plasmid. The start codon of the gag gene has been mutated so that it does not get expressed. Its presence, however,increases the level of retroviral production. | Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:28 | 0 | ||
|
U6+27-20pf Resource Report Resource Website |
RRID:Addgene_21978 | U6 miR-20 perfect | Ampicillin | PMID:17694064 | miR-20 perfect CMV sponge and U6 sponge, 2 sites: CUACCUGCACUAUAAGCACUUUA | Backbone Size:5000; Vector Backbone:U6+27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:29 | 0 | ||
|
U6+27-20 Resource Report Resource Website |
RRID:Addgene_21977 | U6 miR-20 sponge | Ampicillin | PMID:17694064 | Backbone Size:5000; Vector Backbone:U6+27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:29 | 0 | |||
|
U6+27-16pf Resource Report Resource Website |
RRID:Addgene_21976 | U6 miR-16 perfect | Ampicillin | PMID:17694064 | miR-16 perfect CMV sponge and U6 sponge: CGCCAUAUUUACGUGCUGCUA | Backbone Size:5000; Vector Backbone:U6+27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:29 | 0 | ||
|
U6+27-16 Resource Report Resource Website |
RRID:Addgene_21975 | U6 miR-16 sponge | Ampicillin | PMID:17694064 | mir-16 bulged Renilla luciferase reporter, CMV sponge, and U6 sponge, 9 sites AAUAUUCUAUGCUGCUA | Backbone Size:5000; Vector Backbone:U6+27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:29 | 0 | ||
|
pTriEx-mCherry-PA-Rac1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_22027 | PA-Rac1 | Homo sapiens | Ampicillin | PMID:19693014 | Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt. | Backbone Marker:Novagen; Backbone Size:6000; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin | LOV(Leu404-Leu546), Rac1 starts at Ile4 and contains mutations Q61L, E91H and N92H | 2026-07-25 12:44:29 | 22 |
|
pBabe-TetCMV-puro-mVenus-PA-Rac1-C450A Resource Report Resource Website |
RRID:Addgene_22023 | mVenus-PA-Rac1-C450A | Homo sapiens | Ampicillin | PMID:19693014 | Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt. | Backbone Size:6000; Vector Backbone:pBabe-TetCMV-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | The LOV domain contains the mutation C450A.Rac1 starts at I4 and contains mutations Q61L, E91H and N92H. | 2026-07-25 12:44:29 | 0 |
|
pTriEx-mVenus-PA-Rac1-C450A Resource Report Resource Website 1+ mentions |
RRID:Addgene_22021 | PA-Rac1-C450A | Homo sapiens | Ampicillin | PMID:19693014 | Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt. | Backbone Marker:Novagen; Backbone Size:6000; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin | LOV domain contains the light-insensitive C450A mutation. Rac1 starts at I4 and contains mutations Q61L, E91H and N92H. | 2026-07-25 12:44:29 | 2 |
|
pAL119 Resource Report Resource Website |
RRID:Addgene_21909 | hCMV promoter expression cassette | Ampicillin | PMID:15564139 | Backbone Size:6700; Vector Backbone:pAL; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:28 | 0 | |||
|
pSicoR-mCh-Oct4i Resource Report Resource Website 1+ mentions |
RRID:Addgene_21906 | Oct4i | Mus musculus | Ampicillin | PMID:19587682 | Oct4 RNAi sequence 5'-GAACCTGGCTAAGCTTCCA | Backbone Size:7558; Vector Backbone:pSicoR; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:28 | 1 | |
|
9E10.mCHOP(S78&81A).pCDNA1/Amp Resource Report Resource Website 1+ mentions |
RRID:Addgene_21902 | CHOP | Mus musculus | Ampicillin | 9E10 (Myc-epitope) tagged mouse CHOP coding region only, S78A and S81A double mutant. The S78A and S81A mutation introduces an additional HhaI site not present in the wildtype insert. Note that there is considerable uncertainity regarding this plasmid. | Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S78A S81A | 2026-07-25 12:44:28 | 1 | |
|
T7-RelA Resource Report Resource Website 1+ mentions |
RRID:Addgene_21984 | NFkB p65 subunit | Homo sapiens | Ampicillin | PMID:11533489 | Backbone Marker:Matthias P et al. Nucleic Acids Research (1989). 17(15): 6418; Backbone Size:5120; Vector Backbone:pEv3s; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | For more details for this expression construct, as well as associated mutants, please contact: Dr. Lin-Feng Chen ([email protected]) | 2026-07-25 12:44:29 | 8 | |
|
pFLAG-6a-Ataxin3Q22-UIM* Resource Report Resource Website |
RRID:Addgene_22128 | Ataxin 3 | Homo sapiens | Ampicillin | Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV-6a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | UIM 1,2,3 SA-DG | 2026-07-25 12:44:30 | 0 | ||
|
pVETL-Cmcs-Flag-Ataxin3Q80-C14A Resource Report Resource Website |
RRID:Addgene_22121 | Ataxin 3 | Homo sapiens | Ampicillin | PMID:17693639 | Backbone Size:5756; Vector Backbone:pVETL-Cmcs; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | C14A | 2026-07-25 12:44:30 | 0 | |
|
cFGF8 Resource Report Resource Website |
RRID:Addgene_22089 | FGF8 | Gallus gallus | Ampicillin | PMID:8548816 | Chick homolog of mouse FGF8 splice variant 1 clone was isolated from an E10 chick brain cDNA library directionally cloned into lambdaZapII. The insert contains most of the coding region. For antisense probe linearize with EcoRI and use T7 Polymerase. | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript SK (-); Vector Types:Bacterial; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:30 | 0 | |
|
mFGF2 Resource Report Resource Website |
RRID:Addgene_22084 | FGF2 | Mus musculus | Ampicillin | Full length coding region, PCR clone. The insert can be cut out with EcoRI and XbaI. | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:30 | 0 | ||
|
mFGF3 Resource Report Resource Website |
RRID:Addgene_22086 | FGF3 | Mus musculus | Ampicillin | cDNA with longest 5' end; poly A tail lost because cut with EcoRI. | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:30 | 0 | ||
|
pBS119d10L Resource Report Resource Website |
RRID:Addgene_22081 | pBS119d10L | Danio rerio | Ampicillin | PMID:12167406 | To view partial vector sequence from the depositing lab, please click on the Reviews link. | Backbone Marker:Strategene; Backbone Size:3000; Vector Backbone:pBluescript II KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:30 | 0 | |
|
HA-HIF2α MT-pBabe-Hygro Resource Report Resource Website |
RRID:Addgene_22134 | Hypoxia inducible factor 2 alpha | Homo sapiens | Ampicillin | PMID:14691554 | Backbone Size:5573; Vector Backbone:pBabe-Hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | cDNA "silent"("conservative") mutations: GGAGACGGAGGTGTTCTAT mutated to GGAGACCGAAGTCTTCTAT to render cDNA resistant to siRNA #3: 5’-GGAGACGGAGGTGTTCTAT-3’ | 2026-07-25 12:44:30 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
