Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:saccharomyces cerevisiae (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

4,489 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
LHP1472 - EDE1
 
Resource Report
Resource Website 		RRID:Addgene_32238 EDE1 Saccharomyces cerevisiae Ampicillin Vector Backbone:YCplac33; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:25:59 0
LHP1468 - VPS23
 
Resource Report
Resource Website 		RRID:Addgene_32239 VPS23 Saccharomyces cerevisiae Ampicillin HA tag is likely 3xHA and likely C-terminal Backbone Marker:ATCC; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:25:59 0
LHP1048 - pFB-RSP5
 
Resource Report
Resource Website 		RRID:Addgene_32434 RSP5 Saccharomyces cerevisiae Ampicillin Backbone Marker:Invitrogen; Vector Backbone:pFastbac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:26:01 0
LHP1463 - INP52
 
Resource Report
Resource Website 		RRID:Addgene_32432 INP52 Saccharomyces cerevisiae Ampicillin PMID:14761940 INP52 was amplified from yeast genomic DNA using 5′ PstI and 3′ BamHI site-containing oligonucleotides, digested and ligated into PstI- and BamHI-digested YCplac22. The NotI site was inserted at the 5′-end of INP52 via QuikChange™ mutagenesis. A triple HA epitope was ligated into the NotI site to generate pHA-INP52 (LHP1463). Backbone Marker:ATCC; Vector Backbone:YCplac22; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:26:01 0
LHP1049 - pFB-YCK2
 
Resource Report
Resource Website 		RRID:Addgene_32433 YCK2 Saccharomyces cerevisiae Ampicillin Backbone Marker:Invitrogen; Vector Backbone:pFastbac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Y193L 2026-09-12 02:26:01 0
pENTR L1-20XUAS-R5
 
Resource Report
Resource Website 		RRID:Addgene_32302 20XUAS Saccharomyces cerevisiae Kanamycin PMID:21931740 Please see http://www.everyvector.com/sequences/show_public/12859 for additional plasmid map. Backbone Marker:Invitrogen; Backbone Size:2609; Vector Backbone:pDONR 221 P1-P5r; Vector Types:Gateway MultiSite entry vector; Bacterial Resistance:Kanamycin 2026-09-12 02:26:00 0
pENTR R4-GAL4-R3
 
Resource Report
Resource Website 		RRID:Addgene_32309 GAL4 Saccharomyces cerevisiae Kanamycin PMID:21931740 Please see http://www.everyvector.com/sequences/show_public/12862 for additional plasmid map. Backbone Marker:Invitrogen; Backbone Size:2667; Vector Backbone:pDONR 221 P4r-P3r; Vector Types:Gateway MultiSite entry clone; Bacterial Resistance:Kanamycin 2026-09-12 02:26:00 0
LHP1021 - BUL1
 
Resource Report
Resource Website 		RRID:Addgene_32439 BUL1 Saccharomyces cerevisiae Ampicillin Backbone Marker:ATCC; Vector Backbone:YCplac111; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:26:01 0
pRRP51A+intron-LacZ (pHZ18)
 
Resource Report
Resource Website 		RRID:Addgene_33131 RP51A+intron-LacZ Saccharomyces cerevisiae Ampicillin PMID:6308621 GAL-UAS-CYC1-TATA-C7C1-ATG-RP51A+intron-LacZ Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:26:06 0
pLG-Sty
 
Resource Report
Resource Website 		RRID:Addgene_33149 RP51A-synthetic minimal intron Saccharomyces cerevisiae Ampicillin PMID:2655924 Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Sty1 site upstream of intron was cut/filled/ligated to change CCATGG to CCATGCATGG 2026-09-12 02:26:06 0
pLG-Acc
 
Resource Report
Resource Website 		RRID:Addgene_33148 RP51A-synthetic minimal intron Saccharomyces cerevisiae Ampicillin PMID:2655924 Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin AccI site in intron was cut/filled/ligated to change GTCGAC to GTCGCGAC 2026-09-12 02:26:06 0
Gal-Rad51 KR
 
Resource Report
Resource Website 		RRID:Addgene_33232 Rad51 Saccharomyces cerevisiae Ampicillin PMID:20864034 Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin K191R 2026-09-12 02:26:07 0
Gal-Rad51
 
Resource Report
Resource Website 		RRID:Addgene_33230 Rad51 Saccharomyces cerevisiae Ampicillin PMID:20864034 Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:26:07 0
pLG-Nde-Acc
 
Resource Report
Resource Website 		RRID:Addgene_33150 RP51A-synthetic minimal intron Saccharomyces cerevisiae Ampicillin PMID:2655924 Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin AccI site in intron was cut/filled/ligated to change GTCGAC to GTCGCGAC, and NdeI site after intron was cut/filled and a BamHI linker was inserted to obtain the appropriate reading frame changing CATATG to CATACGGGATCC 2026-09-12 02:26:07 0
pLG-deltaA
 
Resource Report
Resource Website 		RRID:Addgene_33151 RP51A-synthetic minimal intron Saccharomyces cerevisiae Ampicillin PMID:2655924 Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Modified intron sequence: GACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin The RP51A sequence was modified by digestion with StyI and HincII, filled in and ligated to delete ~27bp including the 5' splice site 2026-09-12 02:26:07 0
pCSFLPe
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31130 FLP recombinase Saccharomyces cerevisiae Ampicillin PMID:11376165 Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:25:50 2
pJFRC150-20XUAS-IVS-Flp1::PEST
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_32132 Flippase1::PEST Saccharomyces cerevisiae Ampicillin PMID:21831835 Vector Backbone:pJFRC7-20XUAS-IVS-mCD8::GFP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Aspartic Acid at Amino Acid 5 2026-09-12 02:25:58 5
myc ATG18
 
Resource Report
Resource Website 		RRID:Addgene_42530 ATG18 Saccharomyces cerevisiae Ampicillin PMID:22704557 ATG18 was cloned with 300bp upstream and downstream of the gene. The myc tag was added later by mutagenesis. Backbone Size:6112; Vector Backbone:Ycplac111; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin none 2026-09-12 02:27:12 0
pHIS-Hsv2
 
Resource Report
Resource Website 		RRID:Addgene_42524 Hsv2 Saccharomyces cerevisiae Ampicillin PMID:22704557 Backbone Size:5000; Vector Backbone:pHIS2 parallel; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:27:12 0
pSYN-Kex-002
 
Resource Report
Resource Website 		RRID:Addgene_42504 Kex2 protease Saccharomyces cerevisiae Ampicillin PMID:23205847 Backbone Marker:Invitrogen; Backbone Size:5140; Vector Backbone:pcDNA6/V5-His Version C; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:27:12 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

NIDDK Early Research Partnership Engagement Challenge

Funding Opportunity: National NIH K12 DiabDocs Career Development Program

NIH Data Sharing and Reuse Seminar- Sex Differences in Acute Kidney Injury Risk and Outcomes: Insights from MIMIC-III and MIMIC-IV

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch