Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pTriEx-mVenus-PA-Rac1-T17N Resource Report Resource Website 1+ mentions |
RRID:Addgene_22017 | PA-Rac1-T17N | Homo sapiens | Ampicillin | PMID:19693014 | Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt. | Backbone Marker:Novagen; Backbone Size:6000; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin | Rac1 starts at I4 and contains mutation T17N. | 2026-07-25 12:44:29 | 1 |
|
pBabe-TetCMV-puro-mVenus-PA-Rac1-T17N Resource Report Resource Website |
RRID:Addgene_22018 | mVenus-PA-Rac1-T17N | Homo sapiens | Ampicillin | PMID:19693014 | Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt. | Backbone Size:6000; Vector Backbone:pBabe-TetCMV-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Rac1 starts at I4 and contains mutation T17N. | 2026-07-25 12:44:29 | 0 |
|
LZRS-IresGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_21961 | Ires GFP | Ampicillin | PMID:16814714 | Backbone Size:11476; Vector Backbone:LZRS-pBMN-Z-delta; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | GACAGATGACTATGCAGAGAT | 2026-07-25 12:44:29 | 5 | ||
|
pSiP4 Resource Report Resource Website |
RRID:Addgene_21960 | Pten | Mus musculus | Ampicillin | PMID:18327259 | Backbone Size:6273; Vector Backbone:psiCHECK2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:29 | 0 | ||
|
pFlag-CMV2-Brd4 R1337P Resource Report Resource Website |
RRID:Addgene_21939 | BRD4 | Homo sapiens | Ampicillin | PMID:17690245 | Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa 1209-1362 only, R1337P | 2026-07-25 12:44:29 | 0 | |
|
mCHOP10.pCDNA1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21899 | CHOP10 | Mus musculus | Ampicillin and Tetracycline | PMID:1547942 | Note that the phagemid had a scrambled insert and the portion 3' of the CHOP-10 coding region (in red-see author's map) is not from the CHOP gene. If you wish to obtain a CHOP probe for hybridization experiments we suggest excising the HD3-Nhe1 fragment that contains CHOP coding sequence. Note that this plasmid must be propagated in P3-containing host strain such as DH10B/P3 under combined amp (25mcg/ml)/tet (10mcg/ml) selection pressure. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Tetracycline | 2026-07-25 12:44:28 | 1 | |
|
CHOP::GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_21898 | CHOP | Mus musculus | Ampicillin | PMID:11381086 | This reporter gene closely tracks the expression of endogenous CHOP. | Backbone Marker:Promega; Backbone Size:4310; Vector Backbone:pGL3 and pGL2 modified; Vector Types:Non-viral; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:28 | 4 | |
|
BiP 2: C. elegans BiP (hsp-4)-GFP Resource Report Resource Website |
RRID:Addgene_21896 | BiP | Caenorhabditis elegans | Ampicillin | PMID:11780124 | This reporter gene tracks the expression of endogenous BiP (hsp-4) in C. elegans. It consists of a ~1.1 KB genomic C. elegans fragment linked to GFP in the vector pPD95.75. The fusion between the GFP artificial gene and hsp-4 takes place at AA #3 of HSP-4) | Backbone Size:4500; Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | Fusion between the GFP and hsp-4 takes place at AA#3 of HSP-4 | 2026-07-25 12:44:28 | 0 |
|
sc AAV miR26a eGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_21894 | EF1 alpha -miR26a GFP p(A) | Ampicillin | PMID:19524505 | miR-26a sequence is 5'-TTCAAGTAATCCAGGATAGGC Addgene sequencing results confirm the presence of both FseI sites flanking miR-26a. | Backbone Size:3952; Vector Backbone:pEMBL; Vector Types:Mammalian Expression, AAV, sc; Bacterial Resistance:Ampicillin | N/A | 2026-07-25 12:44:28 | 3 | |
|
GAL4-BRD4 Resource Report Resource Website |
RRID:Addgene_21943 | BRD4 | Homo sapiens | Ampicillin | PMID:17690245 | Backbone Size:3396; Vector Backbone:pSG424; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | aa 1209-1362 | 2026-07-25 12:44:29 | 0 | |
|
pFlag-CMV2-Brd4 FEE-AAA Resource Report Resource Website |
RRID:Addgene_21942 | BRD4 | Homo sapiens | Ampicillin | PMID:17690245 | Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa 1209-1362 only, FEE-AAA | 2026-07-25 12:44:29 | 0 | |
|
pCAG-sREACh-Actin Resource Report Resource Website 1+ mentions |
RRID:Addgene_21949 | betaActin | Homo sapiens | Kanamycin | PMID:18512154 | Backbone Size:5802; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:44:29 | 3 | ||
|
mGFP-10-sREACh-N3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21947 | mGFP-10-sREACh | jellyfish | Kanamycin | PMID:18512154 | Backbone Marker:clontech; Backbone Size:3935; Vector Backbone:mGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:44:29 | 4 | ||
|
MuHKI-pGFPN3 Resource Report Resource Website |
RRID:Addgene_21919 | Mutant huamn HKI (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 | Homo sapiens | Kanamycin | PMID:18039843 | Backbone Size:4700; Vector Backbone:pGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | This is the full length human HKI cDNA sequence with a C->A (D657A) mutation in the catalytic site of the enzyme in the C-half. The cDNA is cloned into pGFP-N3 | 2026-07-25 12:44:28 | 0 | |
|
FLHKI-pGFPN3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21917 | Full length human HKI in pGFP-N3 | Homo sapiens | Kanamycin | PMID:18039843 | Backbone Size:4700; Vector Backbone:pGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | This is full length human HKI in pGFP-N3 | 2026-07-25 12:44:28 | 4 | |
|
pAL119-Flt3L Resource Report Resource Website |
RRID:Addgene_21910 | Human Soluble Fms-like Tyrosine Kinase 3 Ligand | Homo sapiens | Ampicillin | PMID:15564139 | Backbone Size:7300; Vector Backbone:pAL119; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:28 | 0 | ||
|
9E10.ChWT.Gal4.pCDNA1/AMP Resource Report Resource Website 1+ mentions |
RRID:Addgene_21914 | CHOP | Mus musculus | Ampicillin | PMID:8650547 | Addgene sequencing results show 6bp insertion in the sequencing adding 2 Gly residues immediately after the Myc tag. Mammalian expression plasmid encoding wildtype mouse CHOP fused to DNA-binding domain of yeast Gal4. | Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:28 | 1 | |
|
CHOP 6: mCHOP-WT-9E10-pcDNA1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21913 | CHOP10 | Mus musculus | Ampicillin and Tetracycline | From depositing lab: "9E10 (Myc-epitope) tagged mouse CHOP coding region only. The insert was joined to the epitope tag using patch-PCR and incorporating unique BamH1 and Xho1 sites for ligation into pcDNA1. Stocks are provided as MC1060 (or MC1061, we are not sure) host strain transformed with the plasmid. Note that pCDNA1 plasmids must be propagated on combined amp and tet selection. I would recommedn that you consider transferring the insert into a better host strain such as pcDNA3" | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Tetracycline | 2026-07-25 12:44:28 | 9 | ||
|
MuHKII-pGFPN3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21922 | Mutant huamn HKII (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 | Homo sapiens | Kanamycin | PMID:18039843 | Backbone Size:4700; Vector Backbone:pGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | This is the full length human HKII cDNA sequence with C->A (D209A and D657A) mutations in the catalytic sites of the enzyme in the N- and C-halves. The cDNA is cloned into pGFP-N3 | 2026-07-25 12:44:28 | 3 | |
|
p3x-FLAG-hnRNPF Resource Report Resource Website 1+ mentions |
RRID:Addgene_21926 | hnRNPF | Homo sapiens | Ampicillin | PMID:18573884 | Backbone Marker:Invitrogen; Backbone Size:4700; Vector Backbone:p3xFLAG-CMV-7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:29 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
