Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 73 showing 1441 ~ 1460 out of 739,423 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/21856

Species: Mus musculus
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: These pEGFP-based plasmids have NEOr marker (and not the conventional AMPr marker). They should be propagated in the presence of 30mcg/ml kanamycin (and not on ampicillin)

Proper citation: RRID:Addgene_21856 Copy   


http://www.addgene.org/21855

Species: Mus musculus
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: These pEGFP-based plasmids have NEOr marker (and not the conventional AMPr marker). They should be propagated in the presence of 30mcg/ml kanamycin (and not on ampicillin)

Proper citation: RRID:Addgene_21855 Copy   


  • RRID:Addgene_21853

    This resource has 1+ mentions.

http://www.addgene.org/21853

Species: Mus musculus
Genetic Insert: mCD36
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFPN-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: These pEGFP-based plasmids have NEOr marker (and not the conventional AMPr marker). They should be propagated in the presence of 30mcg/ml kanamycin (and not on ampicillin)

Proper citation: RRID:Addgene_21853 Copy   


  • RRID:Addgene_21852

    This resource has 1+ mentions.

http://www.addgene.org/21852

Species: Mus musculus
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: These pEGFP-based plasmids have NEOr marker (and not the conventional AMPr marker). They should be propagated in the presence of 30mcg/ml kanamycin (and not on ampicillin)

Proper citation: RRID:Addgene_21852 Copy   


http://www.addgene.org/21850

Species: Mus musculus
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5010; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: Addgene sequencing results show 2 mismatches with author's sequence and NCBI sequence for ATF4. Mouse ATF4 5' UTR and AUG fused to Luciferase driven by the TK promoter in a pGL3 backbone TK.mATF4.UTR.Luc.pGL3 (5202nt, predicted). TK promoter: 58..184; mATF4 5'UTR and AUG: 185..470; luciferase coding sequence: 472..2121; poly A signals: 2156..2377

Proper citation: RRID:Addgene_21850 Copy   


  • RRID:Addgene_21867

    This resource has 1+ mentions.

http://www.addgene.org/21867

Species: Mesoplasma florum
Genetic Insert: Lon
Vector Backbone Description: Backbone Marker:Beckwith Lab; Backbone Size:5352; Vector Backbone:pBAD33; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
References:
Comments: A detailed protocol for purification of mf-lon can be found in the associated paper.

Proper citation: RRID:Addgene_21867 Copy   


http://www.addgene.org/21865

Species: Mus musculus
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_21865 Copy   


http://www.addgene.org/21860

Species: Mus musculus
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: These pEGFP-based plasmids have NEOr marker (and not the conventional AMPr marker). They should be propagated in the presence of 30mcg/ml kanamycin (and not on ampicillin)

Proper citation: RRID:Addgene_21860 Copy   


http://www.addgene.org/21864

Species: Mus musculus
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_21864 Copy   


http://www.addgene.org/21863

Species: Mus musculus
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: These pEGFP-based plasmids have NEOr marker (and not the conventional AMPr marker). They should be propagated in the presence of 30mcg/ml kanamycin (and not on ampicillin)

Proper citation: RRID:Addgene_21863 Copy   


http://www.addgene.org/22008

Species: Homo sapiens
Genetic Insert: PA-Rac1
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pBabe-TetCMV-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt.

Proper citation: RRID:Addgene_22008 Copy   


  • RRID:Addgene_21957

http://www.addgene.org/21957

Species: Mus musculus
Genetic Insert: Pten
Vector Backbone Description: Backbone Size:6273; Vector Backbone:psiCHECK2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_21957 Copy   


  • RRID:Addgene_22007

    This resource has 10+ mentions.

http://www.addgene.org/22007

Species: Homo sapiens
Genetic Insert: PA-Rac1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:6000; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments: Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt. Further remarks from the Hahn lab regarding some mutations in the fluorescent marker: "the C-S mutation was introduced by us to allow site specific labeling of the protein and we have not detected any effect. The F-L mutation reverts the Venus sequence back to the YFP sequence at this site. It will have a very slight detrimental effect on the maturation speed of the chromophore, but will not affect the stability or wavelength of the chromophore. Neither of these 2 mutations will have any effect on the function of the Lov-Rac construct , and the Venus will still function as it should, i.e. as a reporter for the construct."

Proper citation: RRID:Addgene_22007 Copy   


  • RRID:Addgene_21952

http://www.addgene.org/21952

Species: Mus musculus
Genetic Insert: Pten
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCHECK2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_21952 Copy   


  • RRID:Addgene_21967

    This resource has 1+ mentions.

http://www.addgene.org/21967

Species:
Genetic Insert: CMV d2eGFP CXCR4 control sponge
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: From Supplementary Table 1: "CXCR4 bulged Renilla luciferase reporter, 7 sites or 1 site; CMV sponge, 7 sites; U6 spong, 4 sites: AAGUUUUCAGAAAGCUAACA"

Proper citation: RRID:Addgene_21967 Copy   


  • RRID:Addgene_21966

    This resource has 10+ mentions.

http://www.addgene.org/21966

Species: Homo sapiens
Genetic Insert: NFkB p65 subunit
Vector Backbone Description: Backbone Marker:Andersson,S. et al, J. Biol. Chem. 264 (14), 8222-8229 (1989); Backbone Size:4874; Vector Backbone:pCMV4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_21966 Copy   


  • RRID:Addgene_21965

    This resource has 10+ mentions.

http://www.addgene.org/21965

Species: Homo sapiens
Genetic Insert: NF-kB p50 subunit
Vector Backbone Description: Backbone Marker:Andersson,S. et al, J. Biol. Chem. 264 (14), 8222-8229 (1989); Backbone Size:4874; Vector Backbone:pCMV4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_21965 Copy   


  • RRID:Addgene_21964

    This resource has 1+ mentions.

http://www.addgene.org/21964

Species: Homo sapiens
Genetic Insert: si NEDD9
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_21964 Copy   


  • RRID:Addgene_22019

    This resource has 1+ mentions.

http://www.addgene.org/22019

Species: Aequorea Victoria
Genetic Insert: VN173
Vector Backbone Description: Backbone Marker:Fire lab 1995 kit; Backbone Size:3993; Vector Backbone:pPD4983; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
References:
Comments: Hiatt, S.M., Shyu, Y., Duren, H.M, and Hu, C.D. Bimolecular fluorescence complementation (BiFC) analysis of protein interactions in living C. elegans. Methods, 45:185-191 (2008) Multicloning sites betwee Myc and VN173 are avaialble

Proper citation: RRID:Addgene_22019 Copy   


  • RRID:Addgene_22016

http://www.addgene.org/22016

Species: Aequorea Victoria
Genetic Insert: CrN173
Vector Backbone Description: Backbone Size:4694; Vector Backbone:pFLAG-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_22016 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X