Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: cel-lin-4
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231
Proper citation: RRID:Addgene_46649 Copy
Species: Caenorhabditis elegans
Genetic Insert: cel-lsy-6
Vector Backbone Description: Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231
Proper citation: RRID:Addgene_46738 Copy
Species: Caenorhabditis elegans
Genetic Insert: cel-mir-40
Vector Backbone Description: Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231
Proper citation: RRID:Addgene_46739 Copy
Species: Caenorhabditis elegans
Genetic Insert: cel-lin-4
Vector Backbone Description: Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231
Proper citation: RRID:Addgene_46737 Copy
Species: Caenorhabditis elegans
Genetic Insert: cel-mir-230
Vector Backbone Description: Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231
Proper citation: RRID:Addgene_46741 Copy
Species: Caenorhabditis elegans
Genetic Insert: C. elegans UNC-60A cDNA
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET-3a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9452511
Proper citation: RRID:Addgene_48739 Copy
Species: Caenorhabditis elegans
Genetic Insert: snf-5
Vector Backbone Description: Backbone Size:5790; Vector Backbone:pXOON; Vector Types:Mammalian Expression, Xenopus Oocyte Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_48700 Copy
Species: Caenorhabditis elegans
Genetic Insert: NM_058858
Vector Backbone Description: Backbone Size:5052; Vector Backbone:pXOOM; Vector Types:Mammalian Expression, Xenopus Oocyte Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_48704 Copy
Species: Caenorhabditis elegans
Genetic Insert: psdhb-1::mtLS-cpYFP
Vector Backbone Description: Backbone Marker:B. D. Lemire; Backbone Size:3470; Vector Backbone:pSDH2(P-2)GFP; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24522532
Proper citation: RRID:Addgene_51868 Copy
Species: Caenorhabditis elegans
Genetic Insert: Unc-43
Vector Backbone Description: Vector Backbone:pGEX-6P; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23805378
Proper citation: RRID:Addgene_52033 Copy
Species: Caenorhabditis elegans
Genetic Insert: Dre-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5404; Vector Backbone:pcDNA3.1-; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24613396
Proper citation: RRID:Addgene_52513 Copy
Species: Caenorhabditis elegans
Genetic Insert: blmp-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5421; Vector Backbone:pcDNA3.1-; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24613396
Proper citation: RRID:Addgene_52514 Copy
Species: Caenorhabditis elegans
Genetic Insert: unc-22 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GAACCCGTTGCCGAATACAC
Proper citation: RRID:Addgene_58202 Copy
Species: Caenorhabditis elegans
Genetic Insert: 1-207
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958
Proper citation: RRID:Addgene_59554 Copy
Species: Caenorhabditis elegans
Genetic Insert: 1-208
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958
Proper citation: RRID:Addgene_59551 Copy
Species: Caenorhabditis elegans
Genetic Insert: 1-208
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958
Proper citation: RRID:Addgene_59552 Copy
Species: Caenorhabditis elegans
Genetic Insert: cdc-42 promoter
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25377555
Proper citation: RRID:Addgene_59785 Copy
Species: Caenorhabditis elegans
Genetic Insert: elt-2 promoter
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25377555
Proper citation: RRID:Addgene_59783 Copy
Species: Caenorhabditis elegans
Genetic Insert: unc-58(e665) gRNA
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25161212
Proper citation: RRID:Addgene_59931 Copy
Species: Caenorhabditis elegans
Genetic Insert: rol-6(su1006) gRNA
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25161212
Proper citation: RRID:Addgene_59930 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
