Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 71 showing 1401 ~ 1420 out of 1,737 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_208306

http://www.addgene.org/208306

Species: E. coli
Genetic Insert: TadA-RA4.1-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208306 Copy   


  • RRID:Addgene_208300

http://www.addgene.org/208300

Species: E. coli
Genetic Insert: TadA-RA2.1-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208300 Copy   


  • RRID:Addgene_208301

http://www.addgene.org/208301

Species: E. coli
Genetic Insert: TadA-RA3.0-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208301 Copy   


  • RRID:Addgene_208302

http://www.addgene.org/208302

Species: E. coli
Genetic Insert: TadA-RA3.1-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208302 Copy   


http://www.addgene.org/208318

Species: E. coli
Genetic Insert: TadA8r
Vector Backbone Description: Backbone Size:5201; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208318 Copy   


http://www.addgene.org/208319

Species: E. coli
Genetic Insert: TadA8e
Vector Backbone Description: Backbone Size:5201; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208319 Copy   


  • RRID:Addgene_208315

http://www.addgene.org/208315

Species: E. coli
Genetic Insert: TadA-RA5.4-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208315 Copy   


  • RRID:Addgene_208312

http://www.addgene.org/208312

Species: E. coli
Genetic Insert: TadA-RA5.0-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208312 Copy   


  • RRID:Addgene_208313

http://www.addgene.org/208313

Species: E. coli
Genetic Insert: TadA-RA5.1-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208313 Copy   


  • RRID:Addgene_208296

http://www.addgene.org/208296

Species: E. coli
Genetic Insert: TadA8r-R153del-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208296 Copy   


  • RRID:Addgene_208299

http://www.addgene.org/208299

Species: E. coli
Genetic Insert: TadA-RA2.0-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208299 Copy   


  • RRID:Addgene_182962

http://www.addgene.org/182962

Species: E. coli
Genetic Insert: ptsI
Vector Backbone Description: Vector Backbone:pACYC177; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38252823

Proper citation: RRID:Addgene_182962 Copy   


  • RRID:Addgene_182959

http://www.addgene.org/182959

Species: E. coli
Genetic Insert: gRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
Vector Backbone Description: Vector Backbone:CoEi*; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38252823

Proper citation: RRID:Addgene_182959 Copy   


  • RRID:Addgene_212151

http://www.addgene.org/212151

Species: E. coli
Genetic Insert: xylitol dehydrogenase
Vector Backbone Description: Vector Backbone:pMB1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:35842981
Comments: Producing aromatic amino acid from corn husk by using polyols as intermediates (DOI: 10.1016/j.biomaterials.2022.121661)

Proper citation: RRID:Addgene_212151 Copy   


http://www.addgene.org/120558

Species: E. Coli
Genetic Insert: birA
Vector Backbone Description: Backbone Marker:Thermo Scientific; Backbone Size:10682; Vector Backbone:pLEX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30639242

Proper citation: RRID:Addgene_120558 Copy   


  • RRID:Addgene_121046

    This resource has 1+ mentions.

http://www.addgene.org/121046

Species: E. Coli
Genetic Insert: BioID
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pAcGFP1-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30220460

Proper citation: RRID:Addgene_121046 Copy   


  • RRID:Addgene_121049

http://www.addgene.org/121049

Species: E. Coli
Genetic Insert: BioID
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30220460

Proper citation: RRID:Addgene_121049 Copy   


  • RRID:Addgene_121137

    This resource has 1+ mentions.

http://www.addgene.org/121137

Species: E. coli
Genetic Insert: Protein A-Tnp
Vector Backbone Description: Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31431618
Comments: There is a single bp deletion in LacI that changes the C terminal coding sequence to FPDWKAGSERNAINVS. This change does not affect function. Please visit https://doi.org/10.1101/571208 for bioRxiv preprint.

Proper citation: RRID:Addgene_121137 Copy   


  • RRID:Addgene_13532

http://www.addgene.org/13532

Species: E. coli
Genetic Insert: FLIPW-CTYT
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17896864
Comments: For more information, see http://carnegiedpb.stanford.edu/research/frommer/nanosensors/index.html

Proper citation: RRID:Addgene_13532 Copy   


  • RRID:Addgene_13537

    This resource has 1+ mentions.

http://www.addgene.org/13537

Species: E. coli
Genetic Insert: FLIP-E WT
Vector Backbone Description: Backbone Size:2897; Vector Backbone:pRSET-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15939876
Comments: For more information, see http://carnegiedpb.stanford.edu/research/frommer/nanosensors/index.html

Proper citation: RRID:Addgene_13537 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X