Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Krox20 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19179536
Comments: There is a T to C mismatch with Krox20. The single mis-match of the nucleotide is likely to reflect the polymorphism of different mouse strain used in the cloning.
Proper citation: RRID:Addgene_21260 Copy
Species: Caenorhabditis elegans
Genetic Insert: lip-1 M1M2 3'utr in pDONRP2RP3
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pDONRP2RP3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18818082
Proper citation: RRID:Addgene_21381 Copy
Species: Firefly
Genetic Insert: V5-LUC
Vector Backbone Description: Backbone Size:7687; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_21474 Copy
Genetic Insert: Firefly luciferase shRNA
Vector Backbone Description: Backbone Size:7757; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_21472 Copy
Species: Firefly
Genetic Insert: V5-LUC
Vector Backbone Description: Backbone Size:7334; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_21471 Copy
Species: Mus musculus
Genetic Insert: Notch4
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2900; Vector Backbone:pBSKS; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9576833
Proper citation: RRID:Addgene_21470 Copy
Species: Homo sapiens
Genetic Insert: EGLN1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15563275
Proper citation: RRID:Addgene_21404 Copy
Species: Homo sapiens
Genetic Insert: HIF1AN
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12615973
Proper citation: RRID:Addgene_21403 Copy
Species: Homo sapiens
Genetic Insert: autosomal dominant polycystic kidney disease type I
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8500; Vector Backbone:pREP10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12482949
Comments: Please note that Addgene NGS observed a S999P mutation in the PKD1 ORF. The effect of this mutation in unknown.
Proper citation: RRID:Addgene_21368 Copy
Species: Homo sapiens
Genetic Insert: autosomal dominant polycystic kidney disease type I
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4713; Vector Backbone:pCI (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12482949
Comments: *Please note: during Addgene's quality control process, the following mutations were found in PKD1: A691P, M792L, S999P, N1056T, T1724A, M1976V. The depositor has noted that the plasmid appears to be functional using several assays but it is not the standard PKD1 sequence in the database (Genbank ID L33243).
Proper citation: RRID:Addgene_21367 Copy
Species: Homo sapiens
Genetic Insert: autosomal dominant polycystic kidney disease type I
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4713; Vector Backbone:pCI (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12482949
Proper citation: RRID:Addgene_21366 Copy
Species: Mus musculus
Genetic Insert: DEPTOR shRNA 2
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: mouse DEPTOR shRNA 2
TRCN0000110159; NM_145470.1-1165s1c1
shRNA oligo sequence is - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG
Proper citation: RRID:Addgene_21338 Copy
Species: Mus musculus
Genetic Insert: DEPTOR shRNA 1
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: mouse DEPTOR shRNA 1
TRCN0000110157; NM_145470.1-1164s1c1
shRNA oligo sequence is - 5'-CCGGCGCAAGGAAGACATTCACGATCTCGAGATCG
TGAATGTCTTCCTTGCGTTTTTG
Proper citation: RRID:Addgene_21337 Copy
Genetic Insert: I-SceI
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pLew100; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19369939
Comments: There are a few discrepancies between Addgene's sequence and the provided sequence from the depositing lab. These discrepancies do not affect plasmid function.
Proper citation: RRID:Addgene_21299 Copy
Species: Homo sapiens
Genetic Insert: shMTH1-2
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19118192
Comments: shRNA #2 directed against MTH1 sequence 5-GAAATTCCACGGGTACTTCAA-3′.
Proper citation: RRID:Addgene_21298 Copy
Species: Homo sapiens
Genetic Insert: shMTH1-1
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19118192
Comments: shRNA #1 directed against MTH1 sequence 5′-GTGGCTGCTGAACAGCTGCAA-3′.
Proper citation: RRID:Addgene_21297 Copy
Species: Mus musculus
Genetic Insert: Int3
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pLHTC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9576833
Proper citation: RRID:Addgene_21330 Copy
Species: Homo sapiens
Genetic Insert: DEPTOR shRNA 2
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: human DEPTOR shRNA 2
TRC candidate; NM_022783.1-1101s1c1
shRNA oligo sequence - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG
Proper citation: RRID:Addgene_21336 Copy
Species: Homo sapiens
Genetic Insert: DEPTOR shRNA 1
Vector Backbone Description: Backbone Marker:Available from Addgene (#10878); Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: human DEPTOR shRNA 1
TRC candidate; NM_022783.1-877s1c1
shRNA oligo sequence - 5'-CCGGGCCATGACAATCGGAAATCTACTCGAGTAGATTTCCGATTGTCATGGCTTTTTG
Proper citation: RRID:Addgene_21335 Copy
Species: Homo sapiens
Genetic Insert: MTH1
Vector Backbone Description: Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19118192
Comments: The pBabe.puro MTH1 overexpression construct was created by amplifying the MTH1 cDNA from pcDEB.MTH1 (which expresses full-length wild type human MTH1) using PCR
primers to add BamHI and EcoRI cloning sites to the 5' and 3'
ends respectively, and ligating the resulting fragment into the appropriately digested retroviral pBABE puro vector.
Proper citation: RRID:Addgene_21295 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.