Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21344536
Proper citation: RRID:Addgene_26360 Copy
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:0; Vector Backbone:pFRT_DESTFLAGHA; Vector Types:Gateway Cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21344536
Proper citation: RRID:Addgene_26362 Copy
Genetic Insert: attR4-ccdB-attR2
Vector Backbone Description: Backbone Size:8623; Vector Backbone:pDP#MM016b; Vector Types:Bacterial Expression, Worm Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:15489340
Comments: A KpnI-ApaI fragment containing the GFP encoding sequence and the unc-54 3′ UTR from pPD95.79 was cloned into pDP#MM016b. An EcoRV fragment of the attR4-ccdB-attR2 cassette from pDEST-6 (Invitrogen) was cloned into this new construct digested with Acc65I and filled in with Klenow.
The unc-119 rescuing fragment present in these vectors can be used as a marker to select transgenic worms.
Proper citation: RRID:Addgene_26415 Copy
Species: Homo sapiens
Genetic Insert: TAF15
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:5421; Vector Backbone:pFRT_TO_DDESTFLAGHA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22081015
Proper citation: RRID:Addgene_26378 Copy
Species: Homo sapiens
Genetic Insert: SOD1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pAcGFP1-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20221404
Comments: The complete cDNA was subcloned into the vector pET28. Site directed mutagenesis changed wildtype DNA sequence for codon 93 of the cDNA from GGT to GCT, resulting in the G93A mutation in the protein and then a PCR amplified the complete cDNA with EcoRI and SalI sites on the 5’ and 3’ end respectively. This EcoRI-Sal1 0.47kb fragment was cloned into the respective EcoRI and SalI sites of pAcGFP1N1. Thus SOD1 is 5’ of GFP and SOD1 lies upstream of GFP in the SOD1-GFP fusion protein.
Proper citation: RRID:Addgene_26411 Copy
Genetic Insert: attR4-ccdB-attR2 cassette
Vector Backbone Description: Backbone Size:8623; Vector Backbone:pDP#MM016b; Vector Types:Bacterial Expression, Worm Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:15489340
Comments: A HindIII-KpnI fragment containing the attR4-ccdB-attR2 cassette from pDEST-6 (Invitrogen) was cloned into the unc-119 rescue vector pDP#MM016b.
The unc-119 rescuing fragment present in these vectors can be used as a marker to select transgenic worms.
Proper citation: RRID:Addgene_26414 Copy
Species: Homo sapiens
Genetic Insert: FUS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4749; Vector Backbone:pDEST8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22081015
Proper citation: RRID:Addgene_26375 Copy
Species: Homo sapiens
Genetic Insert: FUS
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:5299; Vector Backbone:pFRT_DESTFLAGHA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22081015
Proper citation: RRID:Addgene_26374 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:5299; Vector Backbone:pFRT_DESTFLAGHA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22081015
Proper citation: RRID:Addgene_26377 Copy
Species: Homo sapiens
Genetic Insert: SOD1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pAcGFP1-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20221404
Comments: The complete cDNA was subcloned into the vector pET28. Site directed mutagenesis changed wildtype DNA sequence for codon 85 of the cDNA from GGC to CGC, resulting in the G85R mutation in the protein and then a PCR amplified the complete cDNA with EcoRI and SalI sites on the 5’ and 3’ end respectively. This EcoRI-Sal1 0.47kb fragment was cloned into the respective EcoRI and SalI sites of pAcGFP1N1. Thus SOD1 is 5’ of GFP and SOD1 lies upstream of GFP in the SOD1-GFP fusion protein.
Proper citation: RRID:Addgene_26410 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:5421; Vector Backbone:pFRT_TO_DESTFLAGHA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22081015
Proper citation: RRID:Addgene_26376 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2278; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22081015
Proper citation: RRID:Addgene_26372 Copy
Species: Caenorhabditis elegans
Genetic Insert: Pmyo-2::GFP::unc-54_3'UTR
Vector Backbone Description: Backbone Size:10813; Vector Backbone:pBCN27-R4R3; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20729840
Comments: The full sequence provided is theoretical sequence based on a three way gateway reaction. The order of the elements has been confirmed by PCR, but not fully sequence verified. Expression pattern in worms is as expected.
Use this plasmid as a positive control for testing puromycin selection after single copy insertion by MosSCI at the ttTi5605 locus.
Proper citation: RRID:Addgene_26347 Copy
Species: Mus musculus
Genetic Insert: mmu-mir-1947
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20413612
Comments: pre-miRNA hairpins and the
surrounding regions were amplified from mouse BL6 genomic DNA using Pfu Polymerase and primers with Gateway (Invitrogen)- compatible ends designed to anneal about 100 nt upstream of and downstream from the miRNA hairpins. PCR products were inserted into Gateway vector pDONR221 and subsequently into pcDNA3.2/V5-DEST.
Proper citation: RRID:Addgene_26342 Copy
Species: Mus musculus
Genetic Insert: mmu-mir-1968
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20413612
Comments: pre-miRNA hairpins and the
surrounding regions were amplified from mouse BL6 genomic DNA using Pfu Polymerase and primers with Gateway (Invitrogen)- compatible ends designed to anneal about 100 nt upstream of and downstream from the miRNA hairpins. PCR products were inserted into Gateway vector pDONR221 and subsequently into pcDNA3.2/V5-DEST.
Proper citation: RRID:Addgene_26344 Copy
Species: Mus musculus
Genetic Insert: mmu-mir-1964
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20413612
Comments: pre-miRNA hairpins and the
surrounding regions were amplified from mouse BL6 genomic DNA using Pfu Polymerase and primers with Gateway (Invitrogen)- compatible ends designed to anneal about 100 nt upstream of and downstream from the miRNA hairpins. PCR products were inserted into Gateway vector pDONR221 and subsequently into pcDNA3.2/V5-DEST.
Proper citation: RRID:Addgene_26343 Copy
Species: Mus musculus
Genetic Insert: mmu-mir-1933
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20413612
Comments: pre-miRNA hairpins and the
surrounding regions were amplified from mouse BL6 genomic DNA using Pfu Polymerase and primers with Gateway (Invitrogen)- compatible ends designed to anneal about 100 nt upstream of and downstream from the miRNA hairpins. PCR products were inserted into Gateway vector pDONR221 and subsequently into pcDNA3.2/V5-DEST.
Proper citation: RRID:Addgene_26340 Copy
Species: Homo sapiens
Genetic Insert: lin-28 homolog B
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe.puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19483683
Proper citation: RRID:Addgene_26358 Copy
Species: Homo sapiens
Genetic Insert: Sox2 shRNA
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19801978
Comments: SOX2a shRNA sequence - CGAGATAAACATGGCAATCAA
Proper citation: RRID:Addgene_26353 Copy
Species: Homo sapiens
Genetic Insert: Sox2 shRNA
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19801978
Comments: SOX2b shRNA sequence - CTGCCGAGAATCCATGTATAT
Proper citation: RRID:Addgene_26352 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
