Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 7 showing 121 ~ 140 out of 443,797 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_49409

    This resource has 1+ mentions.

http://www.addgene.org/49409

Species: Drosophila melanogaster
Genetic Insert: dU6-2:gRNA
Vector Backbone Description: Backbone Marker:Norbert Perrimon, Jian-Quan Ni, Harvard; Vector Backbone:pValium22; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25002478
Comments: Please acknowledge Fillip Port and Simon Bullock when publishing work derived from use of this plasmid. Visit crisprflydesign.org for more information.

Proper citation: RRID:Addgene_49409 Copy   


  • RRID:Addgene_49408

    This resource has 1+ mentions.

http://www.addgene.org/49408

Species: Drosophila melanogaster
Genetic Insert: dU6-1:gRNA
Vector Backbone Description: Backbone Marker:Norbert Perrimon, Jian-Quan Ni, Harvard; Vector Backbone:pValium22; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25002478
Comments: Please acknowledge Fillip Port and Simon Bullock when publishing work derived from use of this plasmid. Visit crisprflydesign.org for more information.

Proper citation: RRID:Addgene_49408 Copy   


  • RRID:Addgene_49411

    This resource has 100+ mentions.

http://www.addgene.org/49411

Species: Drosophila melanogaster
Genetic Insert: dU6-1:gRNA
Vector Backbone Description: Backbone Marker:Norbert Perrimon, Jian-Quan Ni, Harvard; Vector Backbone:pValium22; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25002478
Comments: Please acknowledge Fillip Port and Simon Bullock when publishing work derived from use of this plasmid. Visit crisprflydesign.org for more information.

Proper citation: RRID:Addgene_49411 Copy   


  • RRID:Addgene_50554

    This resource has 1+ mentions.

http://www.addgene.org/50554

Species: Drosophila melanogaster
Genetic Insert: Argonaute2
Vector Backbone Description: Backbone Marker:The Drosophila Gateway™ Vector Collection; Vector Backbone:pAFW; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20605501
Comments: Please note that when compared to GenBank reference sequence NP_648775.1, the Ago2 sequence in this plasmid is missing amino acids 49-54 (LQQPQQ).

Proper citation: RRID:Addgene_50554 Copy   


  • RRID:Addgene_37142

http://www.addgene.org/37142

Species: Drosophila melanogaster
Genetic Insert: E2F1-P!P3A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19081076

Proper citation: RRID:Addgene_37142 Copy   


  • RRID:Addgene_37299

http://www.addgene.org/37299

Species: Drosophila melanogaster
Genetic Insert: hopscotch
Vector Backbone Description: Backbone Size:8900; Vector Backbone:pCaSpeR-hs; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7796812
Comments: Perrimon Lab plasmid #99

Proper citation: RRID:Addgene_37299 Copy   


  • RRID:Addgene_37282

http://www.addgene.org/37282

Species: Drosophila melanogaster
Genetic Insert: ovoD1 genomic DNA fragment
Vector Backbone Description: Backbone Size:7815; Vector Backbone:pCaSpeR 2; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8306893
Comments: Perrimon Lab plasmid #25 Please see associated publication for cloning details

Proper citation: RRID:Addgene_37282 Copy   


  • RRID:Addgene_37285

http://www.addgene.org/37285

Species: Drosophila melanogaster
Genetic Insert: orthodenticle
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBlueScript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1979296
Comments: Perrimon Lab plasmid #46

Proper citation: RRID:Addgene_37285 Copy   


  • RRID:Addgene_37393

    This resource has 1+ mentions.

http://www.addgene.org/37393

Species: Drosophila melanogaster
Genetic Insert: SOCS36E enhancer fragment
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression, Luciferase, JAK/STAT reporter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16055650
Comments: Perrimon Lab plasmid #446 A 441-bp genomic fragment in the enhancer of SOCS36E containing two potential STAT92E-binding sites was amplified by PCR, using five different sets of oligos: (1) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (2) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), CTGCAGATACAAAACTGTCTTAGGTGTTTA (PstI); (3) GAATTCGAACCACTCAGAGTGCCTGCGTGT (EcoRI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (4) AGATCTGAACCACTCAGAGTGCCTGCGTGT (BglII), AGATCTATACAAAACTGTCTTAGGTGTTTA (BglII); (5) GCGGCCGCGAACCACTCAGAGTGCCTGCGTGT (NotI), GCGGCCGCATACAAAACTGTCTTAGGTGTTTA (NotI). Each amplified genomic fragment containing different restriction enzyme sites was sequentially subcloned into pUAST. The genomic fragment amplified using the first set of oligos was subcloned into the PstI/EcoRI sites of pUAST to generate 2XSTAT92E. The genomic fragment amplified using the second set of oligos was subcloned into the PstI site of 2XSTAT92E to generate 4XSTAT92E. The genomic fragment amplified using the third set of oligos was subcloned into the EcoRI site of 4XSTAT92E to generate 6XSTAT92E. The genomic fragment amplified using the fourth set of oligos was subcloned into the BglII site of 6XSTAT92E to generate 8XSTAT92E. Next, the hsp70 minimal promoter element was amplified from pUAST by PCR using oligos GCGGCCGCAGCGGAGACTCTAGCGAGCG (NotI) and CTCGAGAATTCCCTATTCAGAGTTCT (XhoI). This hsp70 minimal promoter was subcloned into the NotI/XhoI sites of 8XSTAT92E to generate 8XSTAT92E–hsp70. Again, the genomic fragment amplified using the fifth set of oligos was subcloned into the NotI site of 8XSTAT92E–hsp70 vector to generate 10XSTAT92E–hsp70. Finally, an XhoI/XbaI fragment containing the firefly luciferase gene from the pGL3–luciferase vector (Promega) was subcloned into the XhoI/XbaI sites of 10XSTAT92E–hsp70 to generate 10XSTAT92E–luciferase.

Proper citation: RRID:Addgene_37393 Copy   


  • RRID:Addgene_37280

http://www.addgene.org/37280

Species: Drosophila melanogaster
Genetic Insert: ovoD1 genomic DNA fragment
Vector Backbone Description: Backbone Size:7815; Vector Backbone:pCaSpeR 2; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8306893
Comments: Perrimon Lab plasmid #23 Please see associated publication for cloning details

Proper citation: RRID:Addgene_37280 Copy   


  • RRID:Addgene_37301

http://www.addgene.org/37301

Species: Drosophila melanogaster
Genetic Insert: hopscotch
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7796812
Comments: Perrimon Lab plasmid #100

Proper citation: RRID:Addgene_37301 Copy   


  • RRID:Addgene_37303

http://www.addgene.org/37303

Species: Drosophila melanogaster
Genetic Insert: hopTum-1
Vector Backbone Description: Backbone Marker:Addgene plasmid# 37299; Vector Backbone:pCaShs-hopscotch; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7796812
Comments: Perrimon Lab plasmid #101 The pCaShs-Tum construct was generated by the replacement of a 220 bp SacII-BstEII fragment from pCaShs-hop (Addgene plasmid# 37299) with the same fragment of PCR-generated DNA from hopTum-1 hemizygous flies. This mutation is a G to A transversion at nucleotide 1641 resulting in the substitution of a Glu for a Gly at amino acid 341.

Proper citation: RRID:Addgene_37303 Copy   


  • RRID:Addgene_37304

http://www.addgene.org/37304

Species: Drosophila melanogaster
Genetic Insert: hopTum-1
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7796812
Comments: Perrimon Lab plasmid #102 The pUAS-Tum was made by the insertion of the NotI-XbaI fragment from pCaShs-Tum (Addgene plasmid# 37303) into pUAST.

Proper citation: RRID:Addgene_37304 Copy   


http://www.addgene.org/37376

Species: Drosophila melanogaster
Genetic Insert: porcupine
Vector Backbone Description: Backbone Size:7855; Vector Backbone:pCaSpeR-4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8985181
Comments: Perrimon Lab plasmid #123 The EcoRI-XbaI genomic DNA covering the porc locus was cloned in pCaspeR4 to generate a genomic porc rescue construct.

Proper citation: RRID:Addgene_37376 Copy   


  • RRID:Addgene_37377

http://www.addgene.org/37377

Species: Drosophila melanogaster
Genetic Insert: porcupine
Vector Backbone Description: Vector Backbone:pNB40; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8985181
Comments: Perrimon Lab plasmid #124

Proper citation: RRID:Addgene_37377 Copy   


  • RRID:Addgene_37380

    This resource has 1+ mentions.

http://www.addgene.org/37380

Species: Drosophila melanogaster
Genetic Insert: PolIII-Renilla control reporter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3320; Vector Backbone:pRL-null; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16311596
Comments: Perrimon Lab plasmid #414 The PolIII–Renilla luciferase control construct was generated by PCR amplification of a fragment (base pairs 43,224–43,389 of scaffold AE003823) of the promoter of the D. melanogaster RNA PolIII 128 subunit (RpIII128) with a 5' BglII and a 3' SpeI site and ligation of this fragment into the BglII and SpeI sites of pRL-null.

Proper citation: RRID:Addgene_37380 Copy   


  • RRID:Addgene_37401

http://www.addgene.org/37401

Species: Drosophila melanogaster
Genetic Insert: tout-velu
Vector Backbone Description: Vector Backbone:pNB40; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9665133
Comments: Perrimon Lab plasmid #179

Proper citation: RRID:Addgene_37401 Copy   


  • RRID:Addgene_37745

http://www.addgene.org/37745

Species: Drosophila melanogaster
Genetic Insert: Rab39
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17409086

Proper citation: RRID:Addgene_37745 Copy   


  • RRID:Addgene_37741

http://www.addgene.org/37741

Species: Drosophila melanogaster
Genetic Insert: Rab35
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17409086

Proper citation: RRID:Addgene_37741 Copy   


  • RRID:Addgene_37740

http://www.addgene.org/37740

Species: Drosophila melanogaster
Genetic Insert: Rab32
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17409086

Proper citation: RRID:Addgene_37740 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X