Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 7 showing 121 ~ 140 out of 1,658 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_41065

    This resource has 1+ mentions.

http://www.addgene.org/41065

Vector Backbone Description: Backbone Size:4146; Vector Backbone:pTKIP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20047970

Proper citation: RRID:Addgene_41065 Copy   


  • RRID:Addgene_36436

    This resource has 1+ mentions.

http://www.addgene.org/36436

Genetic Insert: Gateway Cassette
Vector Backbone Description: Vector Backbone:pMartini; Vector Types:Gateway Conversion Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22848718
Comments: This vector can be used for conversion of any cloning vector into a gateway destination vector and facilitate the generation of in-frame fusions with a gateway cassette. A,B or C are reading frames; R1-R2 or R2-R1 indicate the gateway cassette orientation. Please see the associated publication for more information: Wang J-W, Beck ES, McCabe BD (2012) A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila. PLoS ONE 7(7): e42102 http://www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0042102

Proper citation: RRID:Addgene_36436 Copy   


http://www.addgene.org/36425

Genetic Insert: Gateway Cassette
Vector Backbone Description: Vector Backbone:pMartini; Vector Types:Gateway Conversion Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22848718
Comments: This vector can be used for conversion of any cloning vector into a gateway destination vector and facilitate the generation of in-frame fusions with a gateway cassette. A,B or C are reading frames; R1-R2 or R2-R1 indicate the gateway cassette orientation. Please see the associated publication for more information: Wang J-W, Beck ES, McCabe BD (2012) A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila. PLoS ONE 7(7): e42102 http://www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0042102

Proper citation: RRID:Addgene_36425 Copy   


  • RRID:Addgene_164520

http://www.addgene.org/164520

Vector Backbone Description: Vector Backbone:PB-TAG-ERN; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33080218

Proper citation: RRID:Addgene_164520 Copy   


  • RRID:Addgene_16667

http://www.addgene.org/16667

Genetic Insert: mTn7::Gateway cassette
Vector Backbone Description: Backbone Size:14263; Vector Backbone:pGRG37; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16646962
Comments: Grow at 32'C. Contains Gateway cassette with ccdB gene. See author's protocol for more information. This plasmid is designed to insert DNA into the chromosome of Enterobacteria in a manner that doesn't require a drug resistance marker. This plasmid uses the site-specific recombination machinery of the bacterial transposon Tn7. The backbone of the plasmid is the easily curable temperature sensitive mutant of pSC101.

Proper citation: RRID:Addgene_16667 Copy   


http://www.addgene.org/177795

Vector Backbone Description: Backbone Size:10394; Vector Backbone:pDEST-AD-CYH2; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35137167
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.27.453987v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_177795 Copy   


http://www.addgene.org/177798

Vector Backbone Description: Backbone Size:10164; Vector Backbone:pDEST-DB; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35137167
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.27.453987v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_177798 Copy   


http://www.addgene.org/177797

Vector Backbone Description: Backbone Size:10388; Vector Backbone:pDEST-AD-CYH2; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35137167
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.27.453987v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_177797 Copy   


http://www.addgene.org/177809

Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35087108
Comments: This plasmid was designed to tag transcripts of insert at the 3' with an 12X MS2 stem loop tag. Insertion of the transcript of interst is performed by BsaI cloning. 5' BsaI generates ACAG overhang (BsaI recognition site 2659-2664) 3' BsaI generates CCCG overhang (BsaI recognition site 4086-4091) These BsaI sites are lost upon insertion of the transcript of interest.

Proper citation: RRID:Addgene_177809 Copy   


  • RRID:Addgene_178083

http://www.addgene.org/178083

Vector Backbone Description: Backbone Marker:NA, NA, Invitrogen; Vector Backbone:pGP704, pBAD33, pDONR201; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:34801582
Comments: The plasmids from this article are also used with plasmid pXint129 (www.addgene.org/178208).

Proper citation: RRID:Addgene_178083 Copy   


http://www.addgene.org/17555

Species: Mus musculus
Genetic Insert: Foxo1-WT-DBD
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pDNR-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17717603
Comments: This plasmid also contains a E226G mutation--the author has determined that this mutation does not affect the plasmid detrimentally. It also has K219R and L619P polymorphisms.

Proper citation: RRID:Addgene_17555 Copy   


  • RRID:Addgene_176584

http://www.addgene.org/176584

Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for genomic verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca

Proper citation: RRID:Addgene_176584 Copy   


http://www.addgene.org/176586

Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca

Proper citation: RRID:Addgene_176586 Copy   


http://www.addgene.org/168207

Vector Backbone Description: Backbone Size:7721; Vector Backbone:pFRT; Vector Types:Mammalian Expression, Unspecified, pDEST GATEWAY; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30478324

Proper citation: RRID:Addgene_168207 Copy   


  • RRID:Addgene_102563

    This resource has 1+ mentions.

http://www.addgene.org/102563

Vector Backbone Description: Backbone Size:16156; Vector Backbone:PB-SAM; Vector Types:Mammalian Expression, CRISPR, piggybac transposon; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:28918057

Proper citation: RRID:Addgene_102563 Copy   


  • RRID:Addgene_160092

    This resource has 1+ mentions.

http://www.addgene.org/160092

Vector Backbone Description: Backbone Size:9363; Vector Backbone:pLX304 backbone; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32371478

Proper citation: RRID:Addgene_160092 Copy   


  • RRID:Addgene_17392

    This resource has 10+ mentions.

http://www.addgene.org/17392

Vector Backbone Description: Backbone Size:9796; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Comments: Please note that Addgene's quality control sequence shows several gaps with depositor's reference sequence. These gaps are in vector region only and should not affect function.

Proper citation: RRID:Addgene_17392 Copy   


  • RRID:Addgene_17386

    This resource has 1+ mentions.

http://www.addgene.org/17386

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8832; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_17386 Copy   


  • RRID:Addgene_17399

    This resource has 1+ mentions.

http://www.addgene.org/17399

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:9150; Vector Backbone:pQCXIN; Vector Types:Retroviral, RNAi, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_17399 Copy   


http://www.addgene.org/17431

Vector Backbone Description: Backbone Size:10140; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Comments: Please note that there are several sequence discrepancies between Addgene's sequence and depositor's sequence. These mismatches are in backbone regions and should not affect function.

Proper citation: RRID:Addgene_17431 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X