Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 67 showing 1321 ~ 1340 out of 2,178 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_99479

http://www.addgene.org/99479

Species: Rattus norvegicus
Genetic Insert: Evf1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16705037

Proper citation: RRID:Addgene_99479 Copy   

    • RRID:Addgene_180176

http://www.addgene.org/180176

Species: Rattus norvegicus
Genetic Insert: GluN2A
Vector Backbone Description: Vector Backbone:pCDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34977503

Proper citation: RRID:Addgene_180176 Copy   

    • RRID:Addgene_183437

http://www.addgene.org/183437

Species: Rattus norvegicus
Genetic Insert: gRNA and mRuby3 donor
Vector Backbone Description: Vector Backbone:pOC4; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_183437 Copy   

http://www.addgene.org/183438

Species: Rattus norvegicus
Genetic Insert: gRNA and smFP myc donor
Vector Backbone Description: Vector Backbone:pOC4; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_183438 Copy   

http://www.addgene.org/170651

Species: Rattus norvegicus
Genetic Insert: SYT1
Vector Backbone Description: Vector Backbone:pGEX-4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32362337

Proper citation: RRID:Addgene_170651 Copy   

http://www.addgene.org/170646

Species: Rattus norvegicus
Genetic Insert: SYT1
Vector Backbone Description: Vector Backbone:pGEX-4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32362337

Proper citation: RRID:Addgene_170646 Copy   

http://www.addgene.org/170644

Species: Rattus norvegicus
Genetic Insert: SYT1
Vector Backbone Description: Vector Backbone:pGEX-4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32362337

Proper citation: RRID:Addgene_170644 Copy   

http://www.addgene.org/170642

Species: Rattus norvegicus
Genetic Insert: SYT1
Vector Backbone Description: Vector Backbone:FUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32362337

Proper citation: RRID:Addgene_170642 Copy   

http://www.addgene.org/170648

Species: Rattus norvegicus
Genetic Insert: SYT1
Vector Backbone Description: Vector Backbone:pGEX-4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32362337

Proper citation: RRID:Addgene_170648 Copy   

http://www.addgene.org/170649

Species: Rattus norvegicus
Genetic Insert: SYT1
Vector Backbone Description: Vector Backbone:pGEX-4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32362337

Proper citation: RRID:Addgene_170649 Copy   

http://www.addgene.org/179074

Species: Rattus norvegicus
Genetic Insert: TEF2p-Scarlet(rfp)-Link-2xPH
Vector Backbone Description: Vector Backbone:pYTK089 (ColE1, AmpR); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35708612
Comments: Part of the Markerless Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit. Vector cloned using BsaI Golden Gate cloning

Proper citation: RRID:Addgene_179074 Copy   

http://www.addgene.org/179073

Species: Rattus norvegicus
Genetic Insert: TDH3p-Scarlet(rfp)-Link-2xPH
Vector Backbone Description: Vector Backbone:pYTK089 (ColE1, AmpR); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35708612
Comments: Part of the Markerless Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit. Vector cloned using BsaI Golden Gate cloning

Proper citation: RRID:Addgene_179073 Copy   

    • RRID:Addgene_223331

http://www.addgene.org/223331

Species: Rattus norvegicus
Genetic Insert: 3HA-EGFP-miniTurboID-OMP25
Vector Backbone Description: Backbone Size:9000; Vector Backbone:s1300-3XFLAG; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38261530

Proper citation: RRID:Addgene_223331 Copy   

    • RRID:Addgene_223332

http://www.addgene.org/223332

Species: Rattus norvegicus
Genetic Insert: 3HA-miniTurboID-EGFP-OMP25
Vector Backbone Description: Backbone Size:9000; Vector Backbone:s1300-EGFP; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38261530

Proper citation: RRID:Addgene_223332 Copy   

http://www.addgene.org/202555

Species: Rattus norvegicus
Genetic Insert: CRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG)
Vector Backbone Description: Backbone Marker:Dr Konstantin Kogan; Backbone Size:14900; Vector Backbone:pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37226896

Proper citation: RRID:Addgene_202555 Copy   

    • RRID:Addgene_217978

http://www.addgene.org/217978

Species: Rattus norvegicus
Genetic Insert: CREB1
Vector Backbone Description: Vector Backbone:pet21d; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37971402

Proper citation: RRID:Addgene_217978 Copy   

    • RRID:Addgene_217981

http://www.addgene.org/217981

Species: Rattus norvegicus
Genetic Insert: CREB1
Vector Backbone Description: Vector Backbone:pet21d; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37971402

Proper citation: RRID:Addgene_217981 Copy   

http://www.addgene.org/217982

Species: Rattus norvegicus
Genetic Insert: CREB1
Vector Backbone Description: Vector Backbone:pet21d; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37971402

Proper citation: RRID:Addgene_217982 Copy   

    • RRID:Addgene_217980

http://www.addgene.org/217980

Species: Rattus norvegicus
Genetic Insert: CREB1
Vector Backbone Description: Vector Backbone:pet21d; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37971402

Proper citation: RRID:Addgene_217980 Copy   

    • RRID:Addgene_217984

http://www.addgene.org/217984

Species: Rattus norvegicus
Genetic Insert: CREB1
Vector Backbone Description: Vector Backbone:pet21; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37971402

Proper citation: RRID:Addgene_217984 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch