Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 66 showing 1301 ~ 1320 out of 1,664 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_121857

http://www.addgene.org/121857

Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:4202; Vector Backbone:JK104; Vector Types:Mammalian Expression, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691

Proper citation: RRID:Addgene_121857 Copy   


  • RRID:Addgene_121859

http://www.addgene.org/121859

Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:3782; Vector Backbone:JK104; Vector Types:Mammalian Expression, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691

Proper citation: RRID:Addgene_121859 Copy   


http://www.addgene.org/121845

Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:32652; Vector Backbone:IQ013; Vector Types:Adenoviral, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691

Proper citation: RRID:Addgene_121845 Copy   


  • RRID:Addgene_121847

    This resource has 1+ mentions.

http://www.addgene.org/121847

Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:31848; Vector Backbone:IQ013; Vector Types:Adenoviral, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691

Proper citation: RRID:Addgene_121847 Copy   


http://www.addgene.org/121848

Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:5842; Vector Backbone:IY601; Vector Types:Lentiviral, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Comments: 3rd generation lentivirus vector

Proper citation: RRID:Addgene_121848 Copy   


  • RRID:Addgene_121843

http://www.addgene.org/121843

Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:32610; Vector Backbone:pAd/PL-DEST; Vector Types:Adenoviral, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691

Proper citation: RRID:Addgene_121843 Copy   


http://www.addgene.org/121877

Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:4344; Vector Backbone:KX002; Vector Types:Mammalian Expression, PiggyBac Transposon, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Comments: PiggyBac ITR sequences derived from Addgene #63808

Proper citation: RRID:Addgene_121877 Copy   


http://www.addgene.org/121873

Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:4368; Vector Backbone:KX002; Vector Types:Mammalian Expression, PiggyBac Transposon, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Comments: PiggyBac ITR sequences derived from Addgene #63804

Proper citation: RRID:Addgene_121873 Copy   


  • RRID:Addgene_121874

    This resource has 1+ mentions.

http://www.addgene.org/121874

Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:4569; Vector Backbone:KX002; Vector Types:Mammalian Expression, PiggyBac Transposon, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Comments: PiggyBac ITR sequences derived from Addgene #63805

Proper citation: RRID:Addgene_121874 Copy   


  • RRID:Addgene_121875

    This resource has 1+ mentions.

http://www.addgene.org/121875

Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:4764; Vector Backbone:KX002; Vector Types:Mammalian Expression, PiggyBac Transposon, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Comments: PiggyBac ITR sequences derived from Addgene #63806

Proper citation: RRID:Addgene_121875 Copy   


  • RRID:Addgene_122570

http://www.addgene.org/122570

Species: Synthetic
Genetic Insert: beta-lactamase/sfGFP
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pGT-Ah3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30643213
Comments: See supplemental tables of the referenced paper for more information on each plasmid.

Proper citation: RRID:Addgene_122570 Copy   


  • RRID:Addgene_122569

http://www.addgene.org/122569

Species: Synthetic
Genetic Insert: beta-lactamase/sfGFP
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pGT-Ah2; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30643213
Comments: See supplemental tables of the referenced paper for more information on each plasmid.

Proper citation: RRID:Addgene_122569 Copy   


  • RRID:Addgene_122568

http://www.addgene.org/122568

Species: Synthetic
Genetic Insert: beta-lactamase/sfGFP
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pGT-Ah1; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30643213
Comments: See supplemental tables of the referenced paper for more information on each plasmid.

Proper citation: RRID:Addgene_122568 Copy   


  • RRID:Addgene_122848

    This resource has 1+ mentions.

http://www.addgene.org/122848

Vector Backbone Description: Backbone Size:9000; Vector Backbone:pLV-CMV-y/hNubI-tripleFLAG-linker-Gateway-PuroR; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30661429

Proper citation: RRID:Addgene_122848 Copy   


  • RRID:Addgene_122842

    This resource has 1+ mentions.

http://www.addgene.org/122842

Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:7720; Vector Backbone:pcDNA-DEST53; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30661429

Proper citation: RRID:Addgene_122842 Copy   


  • RRID:Addgene_122844

    This resource has 1+ mentions.

http://www.addgene.org/122844

Vector Backbone Description: Backbone Size:7059; Vector Backbone:pDEST-CMV-polysite; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30661429

Proper citation: RRID:Addgene_122844 Copy   


  • RRID:Addgene_109334

    This resource has 10+ mentions.

http://www.addgene.org/109334

Vector Backbone Description: Vector Backbone:pIndcuer20-Blast; Vector Types:Mammalian Expression, Lentiviral, Inducible expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:29148972

Proper citation: RRID:Addgene_109334 Copy   


http://www.addgene.org/109731

Vector Backbone Description: Vector Backbone:pDEST-Tol2-pA2; Vector Types:Zebrafish plasmids; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32709891

Proper citation: RRID:Addgene_109731 Copy   


  • RRID:Addgene_11663

    This resource has 1+ mentions.

http://www.addgene.org/11663

Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8509; Vector Backbone:pPRIME-CMV-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16141338
Comments: CMV promoter transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site. Please note: plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGCTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). Addgene sequence shows that there is a single nucleotide deletion in the targeting sequence(AGCTCCCG-X-TGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). According to the depositing lab, hairpin function is not disrupted.

Proper citation: RRID:Addgene_11663 Copy   


  • RRID:Addgene_85402

    This resource has 10+ mentions.

http://www.addgene.org/85402

Vector Backbone Description: Backbone Size:15069; Vector Backbone:Lenti-CRISPR; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:27458201

Proper citation: RRID:Addgene_85402 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X