Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:4202; Vector Backbone:JK104; Vector Types:Mammalian Expression, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Proper citation: RRID:Addgene_121857 Copy
Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:3782; Vector Backbone:JK104; Vector Types:Mammalian Expression, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Proper citation: RRID:Addgene_121859 Copy
Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:32652; Vector Backbone:IQ013; Vector Types:Adenoviral, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Proper citation: RRID:Addgene_121845 Copy
Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:31848; Vector Backbone:IQ013; Vector Types:Adenoviral, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Proper citation: RRID:Addgene_121847 Copy
Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:5842; Vector Backbone:IY601; Vector Types:Lentiviral, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Comments: 3rd generation lentivirus vector
Proper citation: RRID:Addgene_121848 Copy
Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:32610; Vector Backbone:pAd/PL-DEST; Vector Types:Adenoviral, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Proper citation: RRID:Addgene_121843 Copy
Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:4344; Vector Backbone:KX002; Vector Types:Mammalian Expression, PiggyBac Transposon, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Comments: PiggyBac ITR sequences derived from Addgene #63808
Proper citation: RRID:Addgene_121877 Copy
Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:4368; Vector Backbone:KX002; Vector Types:Mammalian Expression, PiggyBac Transposon, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Comments: PiggyBac ITR sequences derived from Addgene #63804
Proper citation: RRID:Addgene_121873 Copy
Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:4569; Vector Backbone:KX002; Vector Types:Mammalian Expression, PiggyBac Transposon, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Comments: PiggyBac ITR sequences derived from Addgene #63805
Proper citation: RRID:Addgene_121874 Copy
Species: Synthetic
Genetic Insert: Gateway selection cassette (ccdb gene + Chlor resistance gene)
Vector Backbone Description: Backbone Marker:Newgard Lab; Backbone Size:4764; Vector Backbone:KX002; Vector Types:Mammalian Expression, PiggyBac Transposon, pMVP Gateway Destination Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30590691
Comments: PiggyBac ITR sequences derived from Addgene #63806
Proper citation: RRID:Addgene_121875 Copy
Species: Synthetic
Genetic Insert: beta-lactamase/sfGFP
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pGT-Ah3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30643213
Comments: See supplemental tables of the referenced paper for more information on each plasmid.
Proper citation: RRID:Addgene_122570 Copy
Species: Synthetic
Genetic Insert: beta-lactamase/sfGFP
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pGT-Ah2; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30643213
Comments: See supplemental tables of the referenced paper for more information on each plasmid.
Proper citation: RRID:Addgene_122569 Copy
Species: Synthetic
Genetic Insert: beta-lactamase/sfGFP
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pGT-Ah1; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30643213
Comments: See supplemental tables of the referenced paper for more information on each plasmid.
Proper citation: RRID:Addgene_122568 Copy
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pLV-CMV-y/hNubI-tripleFLAG-linker-Gateway-PuroR; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30661429
Proper citation: RRID:Addgene_122848 Copy
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:7720; Vector Backbone:pcDNA-DEST53; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30661429
Proper citation: RRID:Addgene_122842 Copy
Vector Backbone Description: Backbone Size:7059; Vector Backbone:pDEST-CMV-polysite; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30661429
Proper citation: RRID:Addgene_122844 Copy
Vector Backbone Description: Vector Backbone:pIndcuer20-Blast; Vector Types:Mammalian Expression, Lentiviral, Inducible expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:29148972
Proper citation: RRID:Addgene_109334 Copy
Vector Backbone Description: Vector Backbone:pDEST-Tol2-pA2; Vector Types:Zebrafish plasmids; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32709891
Proper citation: RRID:Addgene_109731 Copy
Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8509; Vector Backbone:pPRIME-CMV-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16141338
Comments: CMV promoter transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note: plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGCTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC).
Addgene sequence shows that there is a single nucleotide deletion in the targeting sequence(AGCTCCCG-X-TGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). According to the depositing lab, hairpin function is not disrupted.
Proper citation: RRID:Addgene_11663 Copy
Vector Backbone Description: Backbone Size:15069; Vector Backbone:Lenti-CRISPR; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:27458201
Proper citation: RRID:Addgene_85402 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.