Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: PICK1 (shRNA insensitive) +shRNA towards PICK1
Vector Backbone Description: Backbone Marker:David Baltimore (Caltech); Backbone Size:9941; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21147983
Comments: This is the replacement construct which expresses an shRNA to knockdown the endogenous protein and a recombinant GFP-tagged, shRNA-resistant protein, to replace the endogenous PICK1.
shRNA sequence: CTATGAGTACCGCCTTATCCT
Proper citation: RRID:Addgene_31613 Copy
Species: Rattus norvegicus
Genetic Insert: βarrestin2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15699045
Proper citation: RRID:Addgene_35412 Copy
Species: Rattus norvegicus
Genetic Insert: CD200
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6000; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18296487
Comments: This plasmid contains an intentional G2A mutation in the CD200 sequence to create a consensus Kozak sequence
Proper citation: RRID:Addgene_36152 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase alpha
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Comments: The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations.
Proper citation: RRID:Addgene_33330 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21669867
Comments: Please note that, according to NCBI numbering, the mutations are actually S99A, S494A, S510A.
Proper citation: RRID:Addgene_33320 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Proper citation: RRID:Addgene_33326 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Comments: The truncation was made by placing a stop codon at 460, but sequence was not actually removed.
The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations.
Proper citation: RRID:Addgene_33324 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Proper citation: RRID:Addgene_33329 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase alpha
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Proper citation: RRID:Addgene_33327 Copy
Species: Rattus norvegicus
Genetic Insert: dynamin 2
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_34686 Copy
Species: Rattus norvegicus
Genetic Insert: dynamin 2
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_34687 Copy
Species: Rattus norvegicus
Genetic Insert: Abnormal spindle-like microcephaly associated
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17534152
Comments: Please note that though this plasmid is in the pCMV-myc backbone, the myc tag is NOT in frame with the insert.
Proper citation: RRID:Addgene_27669 Copy
Species: Rattus norvegicus
Genetic Insert: AMPK
α1(1‐312)
Vector Backbone Description: Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: This plasmid was first described in the following article: Crute et al. Functional domains of the alpha1 catalytic subunit of the AMP-activated protein kinase. J Biol Chem (1998) vol. 273 (52) pp. 35347-54.
Proper citation: RRID:Addgene_27632 Copy
Species: Rattus norvegicus
Genetic Insert: Egr3
Vector Backbone Description: Backbone Marker:A.Q. Bakker; Backbone Size:12443; Vector Backbone:LZRSpBMN-linker-IRES-EGFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_27785 Copy
Species: Rattus norvegicus
Genetic Insert: Doublecortin
Vector Backbone Description: Backbone Marker:Addgene plasmid 13770; Backbone Size:4698; Vector Backbone:CALNL-eGFP; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19098909
Proper citation: RRID:Addgene_28310 Copy
Species: Rattus norvegicus
Genetic Insert: TSC2
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14651849
Proper citation: RRID:Addgene_29358 Copy
Species: Rattus norvegicus
Genetic Insert: intrabody against mouse interferon alpha
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4888; Vector Backbone:pcDNA/myc/ER; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30990863
Proper citation: RRID:Addgene_110798 Copy
Species: Rattus norvegicus
Genetic Insert: Doc2alpha
Vector Backbone Description: Backbone Size:9697; Vector Backbone:FUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29754754
Proper citation: RRID:Addgene_128813 Copy
Species: Rattus norvegicus
Genetic Insert: Doc2beta
Vector Backbone Description: Backbone Size:9698; Vector Backbone:FUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29754754
Proper citation: RRID:Addgene_128815 Copy
Species: Rattus norvegicus
Genetic Insert: Doc2beta
Vector Backbone Description: Backbone Size:9698; Vector Backbone:FUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29754754
Proper citation: RRID:Addgene_128814 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
