Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:rattus norvegicus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,178 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
GFP-PICK
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31613 PICK1 (shRNA insensitive) +shRNA towards PICK1 Rattus norvegicus Ampicillin PMID:21147983 This is the replacement construct which expresses an shRNA to knockdown the endogenous protein and a recombinant GFP-tagged, shRNA-resistant protein, to replace the endogenous PICK1. shRNA sequence: CTATGAGTACCGCCTTATCCT Backbone Marker:David Baltimore (Caltech); Backbone Size:9941; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 01:03:51 1
Beta-arrestin2 K11,12R GFP
 
Resource Report
Resource Website 		RRID:Addgene_35412 βarrestin2 Rattus norvegicus Kanamycin PMID:15699045 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin K11,12R 2026-08-29 01:04:22 0
CD200CD4d3+4-His
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36152 CD200 Rattus norvegicus Ampicillin PMID:18296487 This plasmid contains an intentional G2A mutation in the CD200 sequence to create a consensus Kozak sequence Backbone Marker:Yves Durocher, NRC; Backbone Size:6000; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin G2A 2026-08-29 01:04:29 2
pSG5-FLAG-CaMKKbeta N-terminus on CaMKKalpha
 
Resource Report
Resource Website 		RRID:Addgene_33330 Calcium/Calmodulin dependent protein kinase kinase alpha Rattus norvegicus Ampicillin PMID:21807092 The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations. Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin CaMKKbeta N-terminus (1-164) was fused to body for CaMKKalpha (121-505) using PCR based method; S3V, G96R, and P108L also present. 2026-08-29 01:04:08 0
pSG5-FLAG-CaMKKbeta rat S100A, S495A and S511A
 
Resource Report
Resource Website 		RRID:Addgene_33320 Calcium/Calmodulin dependent protein kinase kinase beta Rattus norvegicus Ampicillin PMID:21669867 Please note that, according to NCBI numbering, the mutations are actually S99A, S494A, S510A. Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S99A, S494A, S510A 2026-08-29 01:04:07 0
pSG5-FLAG-CaMKKbeta rat 1-460 K193A
 
Resource Report
Resource Website 		RRID:Addgene_33326 Calcium/Calmodulin dependent protein kinase kinase beta Rattus norvegicus Ampicillin PMID:21807092 Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin truncated at 460, K193A (S3V, G96R, and P108L also present) 2026-08-29 01:04:07 0
pSG5-FLAG-CaMKKbeta rat 1-460
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_33324 Calcium/Calmodulin dependent protein kinase kinase beta Rattus norvegicus Ampicillin PMID:21807092 The truncation was made by placing a stop codon at 460, but sequence was not actually removed. The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations. Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin truncated at 460; S3V, G96R, and P108L also present 2026-08-29 01:04:08 2
pSG5-FLAG-CaMKKalpha N-terminus on CaMKKbeta
 
Resource Report
Resource Website 		RRID:Addgene_33329 Calcium/Calmodulin dependent protein kinase kinase beta Rattus norvegicus Ampicillin PMID:21807092 Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin CaMKKalpha N-terminus(1-128) was fused with CaMKKbeta body (157-587) using PCR based technique 2026-08-29 01:04:07 0
pSG5-FLAG-CaMKKalpha FL WT
 
Resource Report
Resource Website 		RRID:Addgene_33327 Calcium/Calmodulin dependent protein kinase kinase alpha Rattus norvegicus Ampicillin PMID:21807092 Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:04:08 0
wt dynamin 2 pEGFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_34686 dynamin 2 Rattus norvegicus Kanamycin Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin D406G, V664A, H692R and Q758R 2026-08-29 01:04:14 12
K44A dynamin 2 pEGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_34687 dynamin 2 Rattus norvegicus Kanamycin Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin K44A 2026-08-29 01:04:14 6
pCMV-myc-ASPM CTR
 
Resource Report
Resource Website 		RRID:Addgene_27669 Abnormal spindle-like microcephaly associated Rattus norvegicus Ampicillin PMID:17534152 Please note that though this plasmid is in the pCMV-myc backbone, the myc tag is NOT in frame with the insert. Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Contains carboxy terminal region of ASPM (amino acids 2881‑3134) 2026-08-29 01:03:20 0
pEBG‐AMPK
α1(1‐312)
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_27632 AMPK
α1(1‐312) Rattus norvegicus Ampicillin PMID:21205641 This plasmid was first described in the following article: Crute et al. Functional domains of the alpha1 catalytic subunit of the AMP-activated protein kinase. J Biol Chem (1998) vol. 273 (52) pp. 35347-54. Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Constitutively
 active
 by 
truncation 
after 
amino 
acid 
312. 2026-08-29 01:03:20 12
rEgr3/LZRS
 
Resource Report
Resource Website 		RRID:Addgene_27785 Egr3 Rattus norvegicus Ampicillin Backbone Marker:A.Q. Bakker; Backbone Size:12443; Vector Backbone:LZRSpBMN-linker-IRES-EGFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-29 01:03:22 0
CALNL-DCX-eGFP
 
Resource Report
Resource Website 		RRID:Addgene_28310 Doublecortin Rattus norvegicus Ampicillin PMID:19098909 Backbone Marker:Addgene plasmid 13770; Backbone Size:4698; Vector Backbone:CALNL-eGFP; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-29 01:03:29 0
TSC2-S1345A
 
Resource Report
Resource Website 		RRID:Addgene_29358 TSC2 Rattus norvegicus Ampicillin PMID:14651849 Backbone Size:0; Vector Backbone:pCDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S1345A (equivalent to S1389A in rat TSC2 isoform 1) 2026-08-29 01:03:34 0
pCMV-αIFNα-ib
 
Resource Report
Resource Website 		RRID:Addgene_110798 intrabody against mouse interferon alpha Rattus norvegicus Ampicillin PMID:30990863 Backbone Marker:Invitrogen; Backbone Size:4888; Vector Backbone:pcDNA/myc/ER; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 12:51:24 0
pFSW Doc2alpha D291N mutant
 
Resource Report
Resource Website 		RRID:Addgene_128813 Doc2alpha Rattus norvegicus Ampicillin PMID:29754754 Backbone Size:9697; Vector Backbone:FUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin D291N 2026-08-29 12:54:38 0
pFSW Doc2beta D303N mutant
 
Resource Report
Resource Website 		RRID:Addgene_128815 Doc2beta Rattus norvegicus Ampicillin PMID:29754754 Backbone Size:9698; Vector Backbone:FUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin D303N 2026-08-29 12:54:38 0
pFSW Doc2beta WT
 
Resource Report
Resource Website 		RRID:Addgene_128814 Doc2beta Rattus norvegicus Ampicillin PMID:29754754 Backbone Size:9698; Vector Backbone:FUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 12:54:38 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch