Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 63 showing 1241 ~ 1260 out of 2,177 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_74422

http://www.addgene.org/74422

Species: Rattus norvegicus
Genetic Insert: GCaMP3fast
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26527405

Proper citation: RRID:Addgene_74422 Copy   


  • RRID:Addgene_74423

http://www.addgene.org/74423

Species: Rattus norvegicus
Genetic Insert: GCaMP3bright
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26527405

Proper citation: RRID:Addgene_74423 Copy   


http://www.addgene.org/74917

Species: Rattus norvegicus
Genetic Insert: Nanog
Vector Backbone Description: Vector Backbone:pPB-CAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22028025

Proper citation: RRID:Addgene_74917 Copy   


  • RRID:Addgene_75185

http://www.addgene.org/75185

Species: Rattus norvegicus
Genetic Insert: ATP2A3
Vector Backbone Description: Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2553713

Proper citation: RRID:Addgene_75185 Copy   


http://www.addgene.org/75191

Species: Rattus norvegicus
Genetic Insert: SLC8A1
Vector Backbone Description: Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8195112

Proper citation: RRID:Addgene_75191 Copy   


http://www.addgene.org/75190

Species: Rattus norvegicus
Genetic Insert: SLC8A1
Vector Backbone Description: Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8195112

Proper citation: RRID:Addgene_75190 Copy   


http://www.addgene.org/75197

Species: Rattus norvegicus
Genetic Insert: SLC24A2
Vector Backbone Description: Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9461611
Comments: FLAG tag is inserted internal to the protein coding region, as annotated in the annotated sequence file.

Proper citation: RRID:Addgene_75197 Copy   


http://www.addgene.org/75196

Species: Rattus norvegicus
Genetic Insert: SLC24A2
Vector Backbone Description: Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9461611

Proper citation: RRID:Addgene_75196 Copy   


http://www.addgene.org/75209

Species: Rattus norvegicus
Genetic Insert: SLC24A4
Vector Backbone Description: Vector Backbone:pcDNA3.1-V5-His-Topo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_75209 Copy   


  • RRID:Addgene_186577

http://www.addgene.org/186577

Species: Rattus norvegicus
Genetic Insert: AP180
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35852853
Comments: Please note: The plasmid is difficult to sequence near bases 2140-2220 that are within the insert.

Proper citation: RRID:Addgene_186577 Copy   


  • RRID:Addgene_187364

http://www.addgene.org/187364

Species: Rattus norvegicus
Genetic Insert: myosin 1b isoform b motor domain
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4694; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26195670
Comments: PCR cloning at EcoRI-XbaI DNA fragment was generated by PCR on rat Myo1b cDNA with 5' primer ATGGCCAAGAAGGAGGTAAAAT and 3' primer CTGATATCGCTTTTGTTGCGCGT

Proper citation: RRID:Addgene_187364 Copy   


  • RRID:Addgene_186688

http://www.addgene.org/186688

Species: Rattus norvegicus
Genetic Insert: Synaptotagmin 2
Vector Backbone Description: Vector Backbone:pTEV5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35322233

Proper citation: RRID:Addgene_186688 Copy   


  • RRID:Addgene_98705

http://www.addgene.org/98705

Species: Rattus norvegicus
Genetic Insert: Glt1a
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11896154
Comments: Please note that mutation I288V in Glt1a (reference AY069978) was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.

Proper citation: RRID:Addgene_98705 Copy   


  • RRID:Addgene_98706

http://www.addgene.org/98706

Species: Rattus norvegicus
Genetic Insert: Glt1b
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11896154
Comments: Please note that mutations I348V and N365Y in Glt1b (reference AF451299) were found during Addgene's quality control. The depositor noted that these mutations do NOT affect plasmid function.

Proper citation: RRID:Addgene_98706 Copy   


  • RRID:Addgene_99034

http://www.addgene.org/99034

Species: Rattus norvegicus
Genetic Insert: P2rx4 shRNA
Vector Backbone Description: Backbone Size:7649; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26334550
Comments: This plasmid was generated as part of the NIAAA-funded INIA consortium.

Proper citation: RRID:Addgene_99034 Copy   


  • RRID:Addgene_99033

http://www.addgene.org/99033

Species: Rattus norvegicus
Genetic Insert: Il22ra2
Vector Backbone Description: Backbone Size:7649; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25585681
Comments: This plasmid was generated as part of the NIAAA-funded INIA consortium.

Proper citation: RRID:Addgene_99033 Copy   


  • RRID:Addgene_99240

http://www.addgene.org/99240

Species: Rattus norvegicus
Genetic Insert: Hexokinase II
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9278438
Comments: Addgene's QC result found 4 additional mutations (V192A, V378A, M555V, and E699G), that are unexpected; however, the depositor notes that they are away from the catalytic site (and the catalytic site is active).

Proper citation: RRID:Addgene_99240 Copy   


  • RRID:Addgene_99359

    This resource has 1+ mentions.

http://www.addgene.org/99359

Species: Rattus norvegicus
Genetic Insert: Tpm4.2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET3a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28214355

Proper citation: RRID:Addgene_99359 Copy   


  • RRID:Addgene_99479

http://www.addgene.org/99479

Species: Rattus norvegicus
Genetic Insert: Evf1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16705037

Proper citation: RRID:Addgene_99479 Copy   


  • RRID:Addgene_180176

http://www.addgene.org/180176

Species: Rattus norvegicus
Genetic Insert: GluN2A
Vector Backbone Description: Vector Backbone:pCDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34977503

Proper citation: RRID:Addgene_180176 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X