Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: Dominant negative Rheb (D60I)
Vector Backbone Description: Backbone Marker:Addgene plasmid #32519; Vector Backbone:pHAGE-CMV-Rheb-IRES-eGFP-W; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: The published dominant negative D60I mutation was introduced to pHAGE-CMV-Rheb-IRES-eGFP-W by site directed mutagenesis. Although reported to have robust DN activity in other cell types, this construct did not provide robust DN activity in neurons.
The original pHAGE-CMV-IRES lentiviral vector is from Dr Richard C. Mulligan at Harvard (Mostoslavsky G et al., 2005).
Proper citation: RRID:Addgene_32521 Copy
Species: Rattus norvegicus
Genetic Insert: Rheb
Vector Backbone Description: Backbone Size:8450; Vector Backbone:pHAGE-CMV-eGFP-IRES-eGFP-W; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20062052
Comments: Cloning of Rheb into the NotI and BamHI sites of pHAGE-CMV-eGFP-IRES-eGFP-W replaces the first copy of eGFP.
The original pHAGE-CMV-IRES lentiviral vector is from Dr Richard C. Mulligan at Harvard (Mostoslavsky G et al., 2005).
Proper citation: RRID:Addgene_32519 Copy
Species: Rattus norvegicus
Genetic Insert: TRKB
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_32500 Copy
Species: Rattus norvegicus
Genetic Insert: Dynamin I
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12011079
Proper citation: RRID:Addgene_32695 Copy
Species: Rattus norvegicus
Genetic Insert: Dynamin I
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12011079
Proper citation: RRID:Addgene_32696 Copy
Species: Rattus norvegicus
Genetic Insert: Mef2d
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:3176; Vector Backbone:pSuper; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16484497
Comments: Can be used in conjunction with pcDNA3-rMEF2D (Addgene #32902) which is mutated so as to not be targeted by this shRNA.
Proper citation: RRID:Addgene_32900 Copy
Species: Rattus norvegicus
Genetic Insert: G protein alpha 0
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15078878
Proper citation: RRID:Addgene_36396 Copy
Species: Rattus norvegicus
Genetic Insert: beta-arrestin1
Vector Backbone Description: Backbone Size:4969; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17513300
Proper citation: RRID:Addgene_36918 Copy
Species: Rattus norvegicus
Genetic Insert: beta-arrestin2
Vector Backbone Description: Backbone Size:4969; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15501822
Proper citation: RRID:Addgene_36919 Copy
Species: Rattus norvegicus
Genetic Insert: SypHluorin 2x
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19217377
Proper citation: RRID:Addgene_37004 Copy
Species: Rattus norvegicus
Genetic Insert: SypHluorin
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19217377
Proper citation: RRID:Addgene_37003 Copy
Species: Rattus norvegicus
Genetic Insert: ERK2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10521408
Proper citation: RRID:Addgene_37145 Copy
Species: Rattus norvegicus
Genetic Insert: Disabled-1
Vector Backbone Description: Backbone Size:1380; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160654
Proper citation: RRID:Addgene_30139 Copy
Species: Rattus norvegicus
Genetic Insert: AMP-activated Protein Kinase α1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20685962
Proper citation: RRID:Addgene_30305 Copy
Species: Rattus norvegicus
Genetic Insert: AMP-activated Protein Kinase α2 ΔC
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20685962
Proper citation: RRID:Addgene_30307 Copy
Species: Rattus norvegicus
Genetic Insert: Neurofascin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:Modified pEGFP-N1 (see note); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9804856
Comments: This construct DOES NOT contain EGFP- the EGFP has been removed from the pEGFP-N1 backbone.
Proper citation: RRID:Addgene_31061 Copy
Species: Rattus norvegicus
Genetic Insert: Ankyrin G
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11781319
Proper citation: RRID:Addgene_31059 Copy
Species: Rattus norvegicus
Genetic Insert: PSD95 PDZ3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET38a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_31229 Copy
Species: Rattus norvegicus
Genetic Insert: Parkin
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGEX-4T2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21532592
Comments: Joch M. et al, (2007) Parkin-mediated monoubiquitination of the PDZ protein PICK1 regulates the activity of acid-sensing ion channels. Mol. Biol. Cell 18: 3105-18
Proper citation: RRID:Addgene_31255 Copy
Species: Rattus norvegicus
Genetic Insert: PICK1 shRNA
Vector Backbone Description: Backbone Size:9000; Vector Backbone:FUGW+H; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21147983
Comments: PICK1 shRNA: CTATGAGTACCGCCTTATCCT
Proper citation: RRID:Addgene_31614 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
