Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:e. coli (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

1,737 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pBRα-σ70 D581G
 
Resource Report
Resource Website 		RRID:Addgene_53732 RNAP alpha NTD (aa 1-248) fused to E. coli sigma 70 (aa 528-613) E. coli Ampicillin PMID:9121589 This plasmid is used in conjuction with the other Ann Hochschild Bacterial 2-hybrid system plasmids (Addgene plasmids 53730, 53731, 53732, 53733, and 53734) and must be used in the reporter strain, FW102 OL2–62 (Addgene item 53735). Please see the associated article for links to all of these plasmids: http://www.addgene.org/browse/article/8393/ The following articles can provide more information on using the bacterial 2-hybrid system: Dove, et al. 1997 PMID 9121589 Dove and Hochschild 1998 PMID 9499408 Deaconescu, et al. 2006 PMID 16469698 Deighan, et al. 2008 PMID 18832144 Kuznedelov, et al. 2002 PMID 11823642 Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin The sigma 70 moiety carries the D581G substitution 2026-08-15 01:16:33 0
ykgMO-IGS-sfGFP
 
Resource Report
Resource Website 		RRID:Addgene_207231 ykgMO-IGS E. coli Chloramphenicol PMID:37523538 Backbone Marker:p15A ori plasmid; Backbone Size:4770; Vector Backbone:pJBL5034; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-08-15 01:28:55 0
ykgMO-IGS-LuxCDABE
 
Resource Report
Resource Website 		RRID:Addgene_207232 ykgMO-IGS E. coli Chloramphenicol PMID:37523538 Backbone Marker:p15A ori plasmid; Backbone Size:2269; Vector Backbone:pJBL5034; Vector Types:Bacterial Expression, Luciferase, Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-08-15 01:28:54 0
COC053
 
Resource Report
Resource Website 		RRID:Addgene_209131 Enzyme BirA E. coli Ampicillin PMID:9887208 Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:29:07 0
G555
 
Resource Report
Resource Website 		RRID:Addgene_216483 plsB, plsC, cdsA, pssA E. coli Ampicillin PMID:40471122 Please visit https://doi.org/10.1101/2024.03.22.586135 for bioRxiv preprint. Backbone Size:3162; Vector Backbone:pUC57-oriL191-oriR194; Vector Types:Cell-free expression; Bacterial Resistance:Ampicillin 2026-08-15 01:29:28 0
pAS_4xEcoLeuT(CUA)_EF1_AnapRS
 
Resource Report
Resource Website 		RRID:Addgene_174894 AnapRS E. coli Ampicillin PMID:37935196 Backbone Marker:Addgene #140008 based on PB510B-1 (System Bioscience); Vector Backbone:pAS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin L38F, M40G, L41P, Y499V, Y500L, Y527A, H537E, L538S, F541C, A560V 2026-08-15 01:28:06 0
pJS96
 
Resource Report
Resource Website 		RRID:Addgene_207588 GFP-TonBH20A E. coli Ampicillin PMID:37972066 Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin H20A 2026-08-15 01:28:11 0
pJS104
 
Resource Report
Resource Website 		RRID:Addgene_207589 GFP-TolA deltaII E. coli Ampicillin PMID:37972066 Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:28:11 0
pJS61
 
Resource Report
Resource Website 		RRID:Addgene_207585 GFP-TolA E. coli Ampicillin PMID:37972066 Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:28:11 0
pJS65
 
Resource Report
Resource Website 		RRID:Addgene_207587 GFP-TonB E. coli Ampicillin PMID:37972066 Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:28:11 0
pDWJ15
 
Resource Report
Resource Website 		RRID:Addgene_207598 GFP-BBA E. coli Ampicillin PMID:37972066 Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:28:12 0
pDWJ18
 
Resource Report
Resource Website 		RRID:Addgene_207601 GFP-ABA E. coli Ampicillin PMID:37972066 Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:28:15 0
pDWJ22
 
Resource Report
Resource Website 		RRID:Addgene_207602 GFP-AABA E. coli Ampicillin PMID:37972066 Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:28:15 0
pJS110
 
Resource Report
Resource Website 		RRID:Addgene_207591 GFP-AIA H22A E. coli Ampicillin PMID:37972066 Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:28:15 0
pLVX-TetOne-Puro-mitoEcSTH-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_218629 mitoEcSTH E. coli Ampicillin PMID:37884806 Backbone Marker:Clontech; Backbone Size:9227; Vector Backbone:pLVX-TetOne-Puro; Vector Types:Mammalian Expression, Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:29:58 0
pDY380
 
Resource Report
Resource Website 		RRID:Addgene_182962 ptsI E. coli Ampicillin PMID:38252823 Vector Backbone:pACYC177; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:28:43 0
pDY279
 
Resource Report
Resource Website 		RRID:Addgene_182959 gRNA (ttcaggcattttagcatccc), homologous repair template for ptsI E. coli Spectinomycin PMID:38252823 Vector Backbone:CoEi*; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-15 01:28:43 0
pXU01
 
Resource Report
Resource Website 		RRID:Addgene_212151 xylitol dehydrogenase E. coli Spectinomycin PMID:35842981 Producing aromatic amino acid from corn husk by using polyols as intermediates (DOI: 10.1016/j.biomaterials.2022.121661) Vector Backbone:pMB1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:28:45 0
ATMY1
 
Resource Report
Resource Website 		RRID:Addgene_218770 EcNR1GT pUltraBR MjY dtyrS dtyrTV::tolC tyrU::gentR lambda::ZeoR E. coli Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) PMID:30078635 Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) 2026-08-15 01:30:01 0
pEVOL-tac-EcTyrRS-VSMA*-lpp-tRNA_CUA^EcTyr
 
Resource Report
Resource Website 		RRID:Addgene_218766 EcTyrRS-VSMA* E. coli Chloramphenicol PMID:38913984 EcY-tRNA-TAG After the plasmids are propagated, they need to be gel purified by agarose gel because the ATM strains contain a plasmid in their genome. Backbone Size:4091; Vector Backbone:pEVOL-tac; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol Y37V, D167G, D182S, F183M, L186A, D265R 2026-08-15 01:29:59 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch