Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli
Genetic Insert: RNAP alpha NTD (aa 1-248) fused to E. coli sigma 70 (aa 528-613)
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9121589
Comments: This plasmid is used in conjuction with the other Ann Hochschild Bacterial 2-hybrid system plasmids (Addgene plasmids 53730, 53731, 53732, 53733, and 53734) and must be used in the reporter strain, FW102 OL2–62 (Addgene item 53735). Please see the associated article for links to all of these plasmids:
http://www.addgene.org/browse/article/8393/
The following articles can provide more information on using the bacterial 2-hybrid system:
Dove, et al. 1997 PMID 9121589
Dove and Hochschild 1998 PMID 9499408
Deaconescu, et al. 2006 PMID 16469698
Deighan, et al. 2008 PMID 18832144
Kuznedelov, et al. 2002 PMID 11823642
Proper citation: RRID:Addgene_53732 Copy
Species: E. coli
Genetic Insert: ykgMO-IGS
Vector Backbone Description: Backbone Marker:p15A ori plasmid; Backbone Size:4770; Vector Backbone:pJBL5034; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:37523538
Proper citation: RRID:Addgene_207231 Copy
Species: E. coli
Genetic Insert: ykgMO-IGS
Vector Backbone Description: Backbone Marker:p15A ori plasmid; Backbone Size:2269; Vector Backbone:pJBL5034; Vector Types:Bacterial Expression, Luciferase, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:37523538
Proper citation: RRID:Addgene_207232 Copy
Species: E. coli
Genetic Insert: Enzyme BirA
Vector Backbone Description: Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9887208
Proper citation: RRID:Addgene_209131 Copy
Species: E. coli
Genetic Insert: plsB, plsC, cdsA, pssA
Vector Backbone Description: Backbone Size:3162; Vector Backbone:pUC57-oriL191-oriR194; Vector Types:Cell-free expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40471122
Comments: Please visit https://doi.org/10.1101/2024.03.22.586135 for bioRxiv preprint.
Proper citation: RRID:Addgene_216483 Copy
Species: E. coli
Genetic Insert: AnapRS
Vector Backbone Description: Backbone Marker:Addgene #140008 based on PB510B-1 (System Bioscience); Vector Backbone:pAS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37935196
Proper citation: RRID:Addgene_174894 Copy
Species: E. coli
Genetic Insert: GFP-TonBH20A
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066
Proper citation: RRID:Addgene_207588 Copy
Species: E. coli
Genetic Insert: GFP-TolA deltaII
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066
Proper citation: RRID:Addgene_207589 Copy
Species: E. coli
Genetic Insert: GFP-TolA
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066
Proper citation: RRID:Addgene_207585 Copy
Species: E. coli
Genetic Insert: GFP-TonB
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066
Proper citation: RRID:Addgene_207587 Copy
Species: E. coli
Genetic Insert: GFP-BBA
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066
Proper citation: RRID:Addgene_207598 Copy
Species: E. coli
Genetic Insert: GFP-ABA
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066
Proper citation: RRID:Addgene_207601 Copy
Species: E. coli
Genetic Insert: GFP-AABA
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066
Proper citation: RRID:Addgene_207602 Copy
Species: E. coli
Genetic Insert: GFP-AIA H22A
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066
Proper citation: RRID:Addgene_207591 Copy
Species: E. coli
Genetic Insert: mitoEcSTH
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:9227; Vector Backbone:pLVX-TetOne-Puro; Vector Types:Mammalian Expression, Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37884806
Proper citation: RRID:Addgene_218629 Copy
Species: E. coli
Genetic Insert: ptsI
Vector Backbone Description: Vector Backbone:pACYC177; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38252823
Proper citation: RRID:Addgene_182962 Copy
Species: E. coli
Genetic Insert: gRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
Vector Backbone Description: Vector Backbone:CoEi*; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38252823
Proper citation: RRID:Addgene_182959 Copy
Species: E. coli
Genetic Insert: xylitol dehydrogenase
Vector Backbone Description: Vector Backbone:pMB1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:35842981
Comments: Producing aromatic amino acid from corn husk by using polyols as intermediates (DOI: 10.1016/j.biomaterials.2022.121661)
Proper citation: RRID:Addgene_212151 Copy
Species: E. coli
Genetic Insert: EcNR1GT pUltraBR MjY dtyrS dtyrTV::tolC tyrU::gentR lambda::ZeoR
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL)
Defining Citation: PMID:30078635
Proper citation: RRID:Addgene_218770 Copy
Species: E. coli
Genetic Insert: EcTyrRS-VSMA*
Vector Backbone Description: Backbone Size:4091; Vector Backbone:pEVOL-tac; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38913984
Comments: EcY-tRNA-TAG
After the plasmids are propagated, they need to be gel purified by agarose gel because the ATM strains contain a plasmid in their genome.
Proper citation: RRID:Addgene_218766 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.