Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 60 showing 1181 ~ 1200 out of 1,658 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_125153

    This resource has 1+ mentions.

http://www.addgene.org/125153

Species: Other
Genetic Insert: D. pseudoobscura peak #102 enhancer and D. pseudoobscura CG13116 CP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2962; Vector Backbone:Unknown; Vector Types:Insect Expression, Gateway fly expression vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31092928

Proper citation: RRID:Addgene_125153 Copy   


  • RRID:Addgene_125150

    This resource has 1+ mentions.

http://www.addgene.org/125150

Species: Saccharomyces cerevisiae
Genetic Insert: 4 x upstream activating sequence (UAS)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2500; Vector Backbone:Unknown; Vector Types:STAP-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31092928

Proper citation: RRID:Addgene_125150 Copy   


http://www.addgene.org/125151

Species: Other
Genetic Insert: D. pseudoobscura peak #47 enhancer
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3078; Vector Backbone:Unknown; Vector Types:STAP-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31092928

Proper citation: RRID:Addgene_125151 Copy   


  • RRID:Addgene_125549

    This resource has 1+ mentions.

http://www.addgene.org/125549

Vector Backbone Description: Backbone Marker:we built; Backbone Size:10101; Vector Backbone:custom made; Vector Types:Mammalian Expression, Yeast Expression, in vitro expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31467278
Comments: Addgene NGS results identified an IS4-like element located between the Chloramphenicol resistance and ccdB genes. This element will not affect plasmid function. Please visit https://www.biorxiv.org/content/10.1101/530790v1.full for bioRxiv preprint.

Proper citation: RRID:Addgene_125549 Copy   


  • RRID:Addgene_126211

http://www.addgene.org/126211

Species: E.coli
Genetic Insert: ccdB Cassette (BsaI)
Vector Backbone Description: Vector Backbone:pICH47751; Vector Types:Plant Expression, Binary, Module 1; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31085714

Proper citation: RRID:Addgene_126211 Copy   


  • RRID:Addgene_115952

http://www.addgene.org/115952

Species: Synthetic
Genetic Insert: Lvl0 3'UTR Dest
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30327560

Proper citation: RRID:Addgene_115952 Copy   


  • RRID:Addgene_11663

    This resource has 1+ mentions.

http://www.addgene.org/11663

Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8509; Vector Backbone:pPRIME-CMV-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16141338
Comments: CMV promoter transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site. Please note: plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGCTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). Addgene sequence shows that there is a single nucleotide deletion in the targeting sequence(AGCTCCCG-X-TGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). According to the depositing lab, hairpin function is not disrupted.

Proper citation: RRID:Addgene_11663 Copy   


  • RRID:Addgene_121527

    This resource has 1+ mentions.

http://www.addgene.org/121527

Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2900; Vector Backbone:pBlueScript; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21343429
Comments: Contains Gateway Entry Cassette with ccdB gene and chloramphenicol resistance. To make this vector, sequences from the GateWay cassettes of pDONR221 P4r-P3r and pDONR221 P3-P2 were subcloned into pBlueScript. The purpose of this was to create a DONR vector with ampicillin resistance rather than kanamycin resistance, which facilitates use of kanamycin resistant destination vectors. The combination of P4r-P2 att sites enables multisite Gateway cloning in which the N-terminal sequence is cloned into a P1-P4 donor vector and the C-terminal sequence is cloned into this vector, with the destination vector containing P1-P2 att sites.

Proper citation: RRID:Addgene_121527 Copy   


  • RRID:Addgene_24178

http://www.addgene.org/24178

Species: Chloramphenicol resistance gene (CmR) - ccdB gene
Genetic Insert: Chloramphenicol resistance gene (CmR) - ccdB gene
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9956; Vector Backbone:pLenti6/UbC/V5-Dest; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20132838
Comments: V5 tag deleted

Proper citation: RRID:Addgene_24178 Copy   


  • RRID:Addgene_24177

    This resource has 1+ mentions.

http://www.addgene.org/24177

Species: Chloramphenicol resistance gene (CmR) - ccdB gene
Genetic Insert: Chloramphenicol resistance gene (CmR) - ccdB gene
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9998; Vector Backbone:pLenti6/UbC/V5-Dest; Vector Types:Mammalian Expression, Lentiviral, Other, Gateway; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20132838
Comments: V5 tag deleted

Proper citation: RRID:Addgene_24177 Copy   


  • RRID:Addgene_24567

    This resource has 1+ mentions.

http://www.addgene.org/24567

Species: reporter gene mCherry
Vector Backbone Description: Backbone Marker:Scott Barolo; Backbone Size:10462; Vector Backbone:pGreen H-Pelican; Vector Types:reporter construct; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20506180
Comments: AmpR in backbone; CmR in gateway RfA cassette

Proper citation: RRID:Addgene_24567 Copy   


  • RRID:Addgene_24589

http://www.addgene.org/24589

Genetic Insert: Gateway(TM) cassette
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20305087
Comments: The mouse PGK promoter was PCR-amplified and cloned into pLD-puro-CnVA (Plasmid #24587) to generate pLD-puro-PGKnVA. VA= versatile affinity tag, 3XFlag, 6XHis+StrepIII

Proper citation: RRID:Addgene_24589 Copy   


  • RRID:Addgene_24587

    This resource has 1+ mentions.

http://www.addgene.org/24587

Genetic Insert: Gateway(TM) cassette
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20305087
Comments: The CMV promoter from the pLJM1 vector (Addgene) was PCR amplified and cloned into pLD-puro-EnVA using NdeI/NheI to generate pLD-puro-CnVA. pLD-puro-EnVA (pLD-puromycin resistance- EF1alpha, N-terminal VA tag) was generated as described in the paper from pLKO.1 VA tag= versatile affinity tag, 3XFlag+2XTev+6XHis+2XStrepIII

Proper citation: RRID:Addgene_24587 Copy   


  • RRID:Addgene_24592

    This resource has 1+ mentions.

http://www.addgene.org/24592

Genetic Insert: Gateway(TM) cassette
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20305087
Comments: VA= Versatile Affinity tag, 3XFlag+6XHis+StrepIII

Proper citation: RRID:Addgene_24592 Copy   


  • RRID:Addgene_24590

    This resource has 1+ mentions.

http://www.addgene.org/24590

Genetic Insert: Gateway(TM) cassette
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20305087
Comments: pLD-hygro-EnVM was constructed by subcloning the hygromycin resistance gene from the pLJM6 vector (J Moffat, unpublished) into the pLD-puro-EnFH vector using SpeI/NsiI and subsequently subcloning a gene synthesized V5-Myc (VM) tag (Bio Basic Inc.) from the pUC57 host vector. pLD-puro-EnFH (pLD-puromycin resistance- EF1alpha, N-terminus triple Flag-6-His) was generated from pLKO.1 (see paper for details).

Proper citation: RRID:Addgene_24590 Copy   


  • RRID:Addgene_25737

    This resource has 10+ mentions.

http://www.addgene.org/25737

Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:13918; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16945906
Comments: Parent lentivector, co-expression of Hygromycin selection gene

Proper citation: RRID:Addgene_25737 Copy   


  • RRID:Addgene_25735

    This resource has 10+ mentions.

http://www.addgene.org/25735

Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:13286; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16945906
Comments: Parent lentivector, co-expression of Neomycin selection gene

Proper citation: RRID:Addgene_25735 Copy   


  • RRID:Addgene_25916

http://www.addgene.org/25916

Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5566; Vector Backbone:pACT; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20515414

Proper citation: RRID:Addgene_25916 Copy   


  • RRID:Addgene_25895

    This resource has 10+ mentions.

http://www.addgene.org/25895

Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21706014
Comments: There is a Stop codon directly after the Gateway sequence.

Proper citation: RRID:Addgene_25895 Copy   


  • RRID:Addgene_25897

    This resource has 10+ mentions.

http://www.addgene.org/25897

Vector Backbone Description: Backbone Size:9335; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21706014
Comments: There is a Stop codon directly after the Gateway sequence.

Proper citation: RRID:Addgene_25897 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X