Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: calcium channel alpha-1B subunit
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA6/V5-His ABC; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10864934
Comments: Isolated from superior cervical ganglia.
For more information about this plasmid: http://neuroscience.brown.edu/LipscombeLab/homepage/otherpages/clonespage/clonespage1.htm
Also see: GENBANK AF222337
Proper citation: RRID:Addgene_26568 Copy
Species: Rattus norvegicus
Genetic Insert: S6K1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11729323
Proper citation: RRID:Addgene_26610 Copy
Species: Rattus norvegicus
Genetic Insert: calcium channel beta subunit-III
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA3.1/Zeo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Isolated from Rat brain.
Proper citation: RRID:Addgene_26574 Copy
Species: Rattus norvegicus
Genetic Insert: calcium channel alpha-1B subunit
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA6/V5-His ABC; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9010213
Comments: Isolated from superior cervical ganglia.
For more information about this plasmid: http://neuroscience.brown.edu/LipscombeLab/homepage/otherpages/clonespage/clonespage1.htm
Also see: GENBANK AF222337
Proper citation: RRID:Addgene_26570 Copy
Species: Rattus norvegicus
Genetic Insert: GluR1
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pSIN; Vector Types:Sindbis virus production; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19543281
Proper citation: RRID:Addgene_24004 Copy
Species: Rattus norvegicus
Genetic Insert: ARMS
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11150334
Comments: pFLAG-ARMS was generated by ligating two fragments of ARMS- HindIII/KpnI and KpnI/SpeI-- into the HindIII and XbaI sites of pFLAG. The HindIII site was generated by PCR;note that the SpeI and Xba I sites no longer exist after the ligation.
Proper citation: RRID:Addgene_24086 Copy
Species: Rattus norvegicus
Genetic Insert: TrkB
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11157096
Proper citation: RRID:Addgene_24088 Copy
Species: Rattus norvegicus
Genetic Insert: TrkC
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11157096
Proper citation: RRID:Addgene_24089 Copy
Species: Rattus norvegicus
Genetic Insert: TrkA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pDSRed2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_24093 Copy
Species: Rattus norvegicus
Genetic Insert: TrkC
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_24094 Copy
Species: Rattus norvegicus
Genetic Insert: Glucocorticoid Receptor
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLentiLox 3.7; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18347336
Comments: We designed an shRNA targeting the rat GR sequence in the pLentiLox3.7 (ATCC) plasmid carrying a GFP reporter: forward sequence, 5′-tgcgggagaagatgatccattcttcaagagagaatggatcatcttctcccgcttttttgaattc; reverse sequence, 5′-tcgagaattcaaaaaagcgggagaagatgatccattctctcttgaagaatggatcatcttctcccgca.
Proper citation: RRID:Addgene_24095 Copy
Species: Rattus norvegicus
Genetic Insert: NR1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16481433
Comments: The super-ecliptic pHluorin (SEP) coding sequence was inserted three amino acids downstream of the predicted signal peptide cleavage site.
Proper citation: RRID:Addgene_23999 Copy
Species: Rattus norvegicus
Genetic Insert: NR2A
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16481433
Comments: See attached map for additional plasmid features.
The super-ecliptic pHluorin (SEP) coding sequence was inserted three amino acids downstream of the predicted signal peptide cleavage site.
Proper citation: RRID:Addgene_23997 Copy
Species: Rattus norvegicus
Genetic Insert: NR2B
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16481433
Comments: See attached map for additional plasmid features.
The super-ecliptic pHluorin (SEP) coding sequence was inserted three amino acids downstream of the predicted signal peptide cleavage site.
Proper citation: RRID:Addgene_23998 Copy
Species: Rattus norvegicus
Genetic Insert: Pit1
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pRSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2284007
Proper citation: RRID:Addgene_24059 Copy
Species: Rattus norvegicus
Genetic Insert: Gs alpha
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pcDNA1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Tetracycline
Defining Citation: PMID:8863834
Comments: This is Gs alpha with the C-terminal amino acids changed from Gs alpha to Gq alpha residues (QYELL to EYNLV). This construct allows some Gq-coupled receptors to stimulate Adenylate cyclase. There isn't much experience with this chimera at the moment. It may be useful for people who find the AC stimulation is better readout of receptor activation than PLC stimulation.
Contains an internal hemaglutinin epitope tage (DVPDYA) that has no effect on receptor coupling.
Please see supplemental document for G-protein chimera user manual.
Proper citation: RRID:Addgene_24499 Copy
Species: Rattus norvegicus
Genetic Insert: SypHy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3952; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16982422
Comments: The depositing lab notes that the Xba1 and Bcl1 unique restriction digestion sites could be methylated and blocked if the plasmid is grown or maintained in dam+ bacteria.
Also note that in the Addgene-generated map below, the feature listed as "GFP(12-708)" is actually pH sensitive pHluorin.
There is a mutation S446T in Synaptophysin ORF. This change does not have any effect in localizing the construct to the synaptic vesicle and may be a result of a SNP.
Proper citation: RRID:Addgene_24478 Copy
Species: Rattus norvegicus
Genetic Insert: PKCZeta
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14657501
Proper citation: RRID:Addgene_24608 Copy
Species: Rattus norvegicus
Genetic Insert: Farp1
Vector Backbone Description: Vector Backbone:pCAG-BGH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23209303
Proper citation: RRID:Addgene_115501 Copy
Species: Rattus norvegicus
Genetic Insert: Synaptobrevin2
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET31b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28772123
Comments: C103S is an additional mutation compared to NCBI reference- This will not affect plasmid function
Proper citation: RRID:Addgene_115792 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
