Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:4769; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39244484
Comments: Low copy plasmid (pSC101 ori and repA), pUC18 MCS with FLAG epitope integrated at SmaI site, confers streptomycin resistance
Proper citation: RRID:Addgene_225165 Copy
Vector Backbone Description: Backbone Size:4769; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39244484
Comments: Low copy plasmid (pSC101 ori and repA), pUC19 MCS with FLAG epitope integrated at SmaI site, confers streptomycin resistance
Proper citation: RRID:Addgene_225164 Copy
Species: E. coli (Bacteria)
Genetic Insert: potH
Vector Backbone Description: Vector Backbone:PCDF Bravo ; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40154612
Comments: IPTG inducible
Proper citation: RRID:Addgene_216749 Copy
Species: E. coli (Bacteria)
Genetic Insert: potH
Vector Backbone Description: Vector Backbone:PCDF Bravo ; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40154612
Comments: IPTG inducible
Proper citation: RRID:Addgene_216750 Copy
Species: E. coli (Bacteria)
Genetic Insert: potH
Vector Backbone Description: Vector Backbone:PCDF Bravo ; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40154612
Comments: IPTG inducible
Proper citation: RRID:Addgene_216752 Copy
Species: E. coli (Bacteria)
Genetic Insert: potH
Vector Backbone Description: Vector Backbone:PCDF Bravo ; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40154612
Comments: IPTG inducible
Proper citation: RRID:Addgene_216751 Copy
Species: Chryseobacterium sp. JM1
Genetic Insert: ChrH
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37252350
Comments: Also encodes ChrI (no tag)
Proper citation: RRID:Addgene_225083 Copy
Species: Mus musculus
Genetic Insert: TET1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3780; Vector Backbone:pCDF-Duet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:26932196
Proper citation: RRID:Addgene_81053 Copy
Species: Mus musculus
Genetic Insert: TET1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3780; Vector Backbone:pCDF-Duet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:26932196
Proper citation: RRID:Addgene_81054 Copy
Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137
Proper citation: RRID:Addgene_89730 Copy
Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137
Proper citation: RRID:Addgene_89732 Copy
Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137
Proper citation: RRID:Addgene_89731 Copy
Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137
Proper citation: RRID:Addgene_89727 Copy
Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137
Proper citation: RRID:Addgene_89729 Copy
Genetic Insert: GUSPlus::tOCS
Vector Backbone Description: Vector Backbone:pFP100; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170833 Copy
Genetic Insert: FRO6p::GUSPlus::tOCS
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170840 Copy
Genetic Insert: Genotype: MC4100 ∆clpPX
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27732583
Comments: Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20).
The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC.
Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012).
Proper citation: RRID:Addgene_98417 Copy
Species: E. coli
Genetic Insert: PPhlF-PBetI-YFP
Vector Backbone Description: Backbone Marker:Alec Nielsen; Backbone Size:3359; Vector Backbone:pAN4020; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27034378
Proper citation: RRID:Addgene_74698 Copy
Species: Acetobacter aceti 1023
Genetic Insert: formylglycinamidine ribonucleotide synthetase, small subunit
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Comments: pCloDF13 replicon
Proper citation: RRID:Addgene_72516 Copy
Species: Acetobacter aceti 1023
Genetic Insert: formylglycinamidine ribonucleotide synthetase, small subunit
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Comments: pCloDF13 replicon
Proper citation: RRID:Addgene_72517 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
