Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:e. coli (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

1,737 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pFP125
 
Resource Report
Resource Website 		RRID:Addgene_21674 LacZ E. coli Ampicillin PMID:9343441 Derived from Ted, a centromeric plasmid (provided by W. Kramer) marked by the URA3 gene. Contains two copies of the Escherichia coli lacZ gene in inverted orientation, with one copy containing an HO endonuclease cleavage site. Please note: Addgene was not able to sequence verify the critical features of this plasmid due to its repetitive nature. Backbone Marker:W. Kramer; Backbone Size:0; Vector Backbone:Ted; Vector Types:centromeric plasmid; Bacterial Resistance:Ampicillin The second lacZ sequence has been completely deleted, and there is no homologous sequence. 2026-08-29 01:02:04 0
pFP122
 
Resource Report
Resource Website 		RRID:Addgene_21669 Lacz E. coli Ampicillin PMID:9343441 Derived from Ted, a centromeric plasmid (provided by W. Kramer) marked by the URA3 gene. Contains two copies of the Escherichia coli lacZ gene in inverted orientation, with one copy containing an HO endonuclease cleavage site. Please note: Addgene was not able to sequence verify the critical features of this plasmid due to its repetitive nature. Backbone Marker:W. Kramer; Backbone Size:0; Vector Backbone:Ted; Vector Types:centromeric plasmid; Bacterial Resistance:Ampicillin The second lacZ sequence has been modified, the EcoRV/BclI fragment has been replaced by a 36-bp sequence (AG TTTCAGCTTTCCGCAATAGTATAATTTTATAAAC) which differs from an HO cut site by only one substitution but cannot be cut 2026-08-29 01:02:07 0
pXDC61
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21841 blaM E. coli Chloramphenicol PMID:19578436 Backbone Size:9024; Vector Backbone:pMMB207C; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-29 01:02:13 3
pCK389.AAV
 
Resource Report
Resource Website 		RRID:Addgene_177327 SoxS E. coli Chloramphenicol PMID:34800362 Vector Backbone:p15A; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol R93A,S101A 2026-08-29 01:00:55 0
FLIPrbs Q235A
 
Resource Report
Resource Website 		RRID:Addgene_17862 FLIPrbs Q235A E. coli Ampicillin PMID:14550551 Q235A was generated using QuikChange (Stratagene) in the mutant background of FLIPrib-250n. Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSET-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Q235A 2026-08-29 01:01:08 0
FLIPrbs F15A
 
Resource Report
Resource Website 		RRID:Addgene_17863 FLIPrbs F15A E. coli Ampicillin PMID:14550551 F15A was generated using QuikChange (Stratagene) in the mutant background of FLIPrib-250n. Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSET-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin F15A 2026-08-29 01:01:07 0
pcDNA3.1 FLII12Pglu-700uDelta6
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_17866 FLII12Pglu-700uDelta6 E. coli Ampicillin PMID:18177733 Backbone Marker:Invitrogen; Backbone Size:5409; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 700uDelta6, ECFP insert in mglB 2026-08-29 01:01:08 33
EC.RNe.TYB1.a1-395.wt
 
Resource Report
Resource Website 		RRID:Addgene_17950 Escherichia coli RNase E residues 1-395 E. coli Ampicillin PMID:16854990 Backbone Marker:New England Biolabs; Backbone Size:7280; Vector Backbone:pTYB1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin residues 1-395 2026-08-29 01:01:13 0
pACYC-FLAG-dN6-His
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22143 Flag-clpXdeltaNLinkedHexamer-His6 E. coli Chloramphenicol PMID:16237435 Backbone Marker:modifiedNovagen; Backbone Size:3500; Vector Backbone:pACYC.pET24cloning; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-29 01:02:09 2
pB33eCPX
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23336 Enhanced Circularly Permuted Outer Membrane Protein X E. coli Chloramphenicol PMID:18480093 Backbone Size:5400; Vector Backbone:pBAD33; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-29 01:02:20 8
pBEL2290
 
Resource Report
Resource Website 		RRID:Addgene_164596 MlaFEDCB E. coli Ampicillin PMID:33236984 Vector Backbone:pBAD-His; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin MlaF-(6xHis-MlaE)-MlaD(Gly11Phe)-MlaC-MlaB 2026-08-29 12:59:18 0
pBEL2292
 
Resource Report
Resource Website 		RRID:Addgene_164598 MlaFEDCB E. coli Ampicillin PMID:33236984 Vector Backbone:pBAD-His; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin MlaF-(6xHis-MlaE)-MlaD(Gly11Phe, Ile12Phe)-MlaC-MlaB 2026-08-29 12:59:17 0
pBEL2295
 
Resource Report
Resource Website 		RRID:Addgene_164600 MlaFEDCB E. coli Ampicillin PMID:33236984 Vector Backbone:pBAD-His; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin MlaF-(6xHis-MlaE)-MlaD(Ala17Phe)-MlaC-MlaB 2026-08-29 12:59:18 0
pBEL2298
 
Resource Report
Resource Website 		RRID:Addgene_164603 MlaFEDCB E. coli Ampicillin PMID:33236984 Vector Backbone:pBAD-His; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin MlaF-(6xHis-MlaE)-MlaD(Ala17Phe, Ala20Phe, Val24Phe)-MlaC-MlaB 2026-08-29 12:59:18 0
pVER-LacI
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_164830 LacI E. coli Kanamycin PMID:33784029 Derived from the pAN1818 plasmid from the Chris Voigt lab. Vector Backbone:pAN1818; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 12:59:20 1
pTY1-LacI
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_164831 LacI E. coli Kanamycin PMID:33784029 Vector Backbone:pAN1818; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 12:59:19 1
pET19b-EcMscL-TEV-mEGFP
 
Resource Report
Resource Website 		RRID:Addgene_165097 E. Coli Mechanosensitive Channel of Large Conductance E. coli Ampicillin PMID:30760590 Backbone Size:5600; Vector Backbone:pET19b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-29 12:59:22 0
pBSR
 
Resource Report
Resource Website 		RRID:Addgene_165838 bsr E. Coli Ampicillin PMID:34525356 CDS Backbone Size:3057; Vector Backbone:pUPD; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-29 12:59:26 0
pspy_STD
 
Resource Report
Resource Website 		RRID:Addgene_165806 spy E. Coli Ampicillin PMID:34525356 Bacterial Terminator Backbone Size:2656; Vector Backbone:pUPD4; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 12:59:29 0
pEcCas6
 
Resource Report
Resource Website 		RRID:Addgene_170091 E. coli type I-E Cas6 E. coli Kanamycin PMID:34985758 If used in a publication, please acknowledge that the plasmid pEcCas6 was generated by U.S. Department of Energy Joint Genome Institute, a DOE Office of Science User Facility. The associated work was supported by the Office of Science of the U.S. Department of Energy under Contract No. DE-AC02-05CH11231. Backbone Size:5218; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-29 12:59:54 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch