Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 54 showing 1061 ~ 1080 out of 1,969 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_97315

http://www.addgene.org/97315

Species: Synthetic
Genetic Insert: Actb MMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agtccgcctagaagcacttg

Proper citation: RRID:Addgene_97315 Copy   


  • RRID:Addgene_97316

http://www.addgene.org/97316

Species: Synthetic
Genetic Insert: Actb NHEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agtccgcctagaagcacttg

Proper citation: RRID:Addgene_97316 Copy   


  • RRID:Addgene_97319

    This resource has 1+ mentions.

http://www.addgene.org/97319

Species: Synthetic
Genetic Insert: Cdx2 HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agaccacgggaggggtcact

Proper citation: RRID:Addgene_97319 Copy   


  • RRID:Addgene_97321

http://www.addgene.org/97321

Species: Synthetic
Genetic Insert: Nanog HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: cgtaagtctcatatttcacc

Proper citation: RRID:Addgene_97321 Copy   


  • RRID:Addgene_97322

http://www.addgene.org/97322

Species: Synthetic
Genetic Insert: Sox2 HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: tgcccctgtcgcacatgtga

Proper citation: RRID:Addgene_97322 Copy   


  • RRID:Addgene_91569

    This resource has 1+ mentions.

http://www.addgene.org/91569

Species: E. coli
Genetic Insert: AraC/PBAD
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:4559; Vector Backbone:pSAM_Ec; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28614382
Comments: Mariner himar1C9 transposase driven by an arabinose promoter on an R6K gamma suicide plasmid. The transposon allows identification of fitness factors by Illumina sequencing. This transposon will randomly insert a kanamycin resistance cassette into genomic TA sites. Ampicillin resistance is contained on the plasmid backbone. For further background, see: Goodman, Andrew L., Meng Wu, and Jeffrey I. Gordon. “Identifying Microbial Fitness Determinants by Insertion Sequencing (INSeq) Using Genome-Wide Transposon Mutant Libraries.” Nature Protocols 6.12 (2011): 1969–1980. PMC. Web. 11 Apr. 2017. Wiles, Travis J. et al. “Combining Quantitative Genetic Footprinting and Trait Enrichment Analysis to Identify Fitness Determinants of a Bacterial Pathogen.” Ed. Danielle A. Garsin. PLoS Genetics 9.8 (2013): e1003716. PMC. Web. 11 Apr. 2017.

Proper citation: RRID:Addgene_91569 Copy   


  • RRID:Addgene_171127

    This resource has 1+ mentions.

http://www.addgene.org/171127

Species: Other
Genetic Insert: OsTIR1-F74A
Vector Backbone Description: Vector Backbone:pDB4697; Vector Types:Other; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:34849776
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.19.452993v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_171127 Copy   


  • RRID:Addgene_171125

http://www.addgene.org/171125

Species: S. pombe (fission yeast)
Genetic Insert: ura4
Vector Backbone Description: Backbone Marker:TransGen Biotech; Vector Backbone:pEASY-blunt; Vector Types:Other; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:34849776
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.19.452993v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_171125 Copy   


  • RRID:Addgene_83959

http://www.addgene.org/83959

Species: Synthetic
Genetic Insert: Internal Control sequence
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3929; Vector Backbone:pCR2.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Comments: This plasmid was created in the FDA ORA lab.

Proper citation: RRID:Addgene_83959 Copy   


  • RRID:Addgene_8487

http://www.addgene.org/8487

Species: Bacteria
Genetic Insert: miniTN7
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:4163; Vector Backbone:pTrc99A; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:8384534

Proper citation: RRID:Addgene_8487 Copy   


  • RRID:Addgene_87848

http://www.addgene.org/87848

Species: Homo sapiens
Genetic Insert: Homo sapiens hemoglobin subunit beta (HBB), Aberrant cDNA fragment (Exon1/19nt mispliced Intron1 + Exon2)
Vector Backbone Description: Backbone Marker:Invitrogen (Life Technologies); Backbone Size:3930; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:32933098

Proper citation: RRID:Addgene_87848 Copy   


  • RRID:Addgene_80491

    This resource has 1+ mentions.

http://www.addgene.org/80491

Species: Synthetic
Genetic Insert: CAG-GFP
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pCR-TOPO; Vector Types:Mammalian Expression, donor vector (human); Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:26707206
Comments: Constructed from Addgene plasmid #22075

Proper citation: RRID:Addgene_80491 Copy   


  • RRID:Addgene_80811

    This resource has 10+ mentions.

http://www.addgene.org/80811

Species: Synthetic
Genetic Insert: sfGFP-piggyBac-DsRed
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR™4-TOPO; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin

Proper citation: RRID:Addgene_80811 Copy   


  • RRID:Addgene_80822

    This resource has 1+ mentions.

http://www.addgene.org/80822

Species: Synthetic
Genetic Insert: 2xHA-piggyBac-DsRed
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR™4-TOPO; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin

Proper citation: RRID:Addgene_80822 Copy   


  • RRID:Addgene_214737

    This resource has 1+ mentions.

http://www.addgene.org/214737

Species: Homo sapiens
Genetic Insert: AAVS1-eTLR
Vector Backbone Description: Backbone Size:3948; Vector Backbone:pBlueScript; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:38302659

Proper citation: RRID:Addgene_214737 Copy   


  • RRID:Addgene_209544

http://www.addgene.org/209544

Species: Synthetic
Genetic Insert: Recombination into the S. alvi wkB2 genome w/in the SALWKB2_RS11215/SALWKB2_RS11220 intergenic region
Vector Backbone Description: Backbone Size:1886; Vector Backbone:pYTK095; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:37786689
Comments: Please visit https://doi.org/10.1101/2023.09.19.558440 for bioRxiv preprint.

Proper citation: RRID:Addgene_209544 Copy   


http://www.addgene.org/211830

Species: Synthetic
Genetic Insert: mVenus-FLAG-Kan
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin

Proper citation: RRID:Addgene_211830 Copy   


  • RRID:Addgene_208363

http://www.addgene.org/208363

Species: Mus musculus
Genetic Insert: Fzd6
Vector Backbone Description: Vector Backbone:pCR2.1; Vector Types:cloning vector; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:37622728

Proper citation: RRID:Addgene_208363 Copy   


http://www.addgene.org/208364

Species: Mus musculus
Genetic Insert: Fzd6
Vector Backbone Description: Vector Backbone:pCR2.1; Vector Types:cloning vector; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:37622728

Proper citation: RRID:Addgene_208364 Copy   


  • RRID:Addgene_203752

http://www.addgene.org/203752

Species: Homo sapiens
Genetic Insert: trPAG
Vector Backbone Description: Backbone Marker:Ilya Levental lab; Vector Backbone:trLAT-mRFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:36997644

Proper citation: RRID:Addgene_203752 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X