Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: C-terminal domain (327-970) containing 5 impaired Edc3 binding sites (5 additional HLMs in C-terminal domain); N-terminal domain (1-299) including first HLM is removed.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163581 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163585 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Impaired Edc3 binding site (first HLM); impaired RNA cap recognition site (W50, D54).
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163580 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163574 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Lacking C-terminal domain.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163577 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MAT Z1
Vector Backbone Description: Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t, Daran Lab; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: Addgene QC identified differences to the theoretical sequence that the depositing lab does not believe are of functional concern.
Proper citation: RRID:Addgene_166099 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL2
Vector Backbone Description: Backbone Marker:Smith JD et al 2016. PMID 26956608; Vector Backbone:pRS414; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA Binding Coordinates: chrXII:291472..291491 (- strand) This is a yeast integration plasmid, and should be linearized with BstZ17I (or elsewhere within the TRP1 gene) before transformation for integration into Chromosome V of the yeast genome
Proper citation: RRID:Addgene_166088 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CUP1-1
Vector Backbone Description: Backbone Marker:Smith JD et al 2016. PMID 26956608; Vector Backbone:pRS414; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA Binding Coordinates: chrVIII:212613..212632 (- strand) This is a yeast integration plasmid, and should be linearized with BstZ17I (or elsewhere within the TRP1 gene) before transformation for integration into Chromosome V of the yeast genome
Proper citation: RRID:Addgene_166086 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MET16
Vector Backbone Description: Backbone Marker:Smith JD et al 2016. PMID 26956608; Vector Backbone:pRS414; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA Binding Coordinates: chrXVI:877523..877542 (+ strand) This is a yeast integration plasmid, and should be linearized with BstZ17I (or elsewhere within the TRP1 gene) before transformation for integration into Chromosome V of the yeast genome.
Addgene QC identified several discrepancies compared to the theoretical reference.
Proper citation: RRID:Addgene_166091 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Promoter of RPL22A
Vector Backbone Description: Backbone Marker:Smith JD et al 2016. PMID 26956608; Vector Backbone:pRS414; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA Binding Coordinates: chrXII:263006..263025 (- strand) This is a yeast integration plasmid, and should be linearized with BstZ17I (or elsewhere within the TRP1 gene) before transformation for integration into Chromosome V of the yeast genome.
Addgene QC identified discrepancies compared to the theoretical sequence. The depositing lab confirms the functional activity of the construct despite these differences.
Proper citation: RRID:Addgene_166079 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Promoter of RPL39 (Overlaps with 5'UTR and first base of gene)
Vector Backbone Description: Backbone Marker:Smith JD et al 2016. PMID 26956608; Vector Backbone:pRS414; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA Binding Coordinates: chrX: 75914-75933 (+ strand) This is a yeast integration plasmid, and should be linearized with BstZ17I (or elsewhere within the TRP1 gene) before transformation for integration into Chromosome V of the yeast genome
Proper citation: RRID:Addgene_166078 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SLA1
Vector Backbone Description: Backbone Marker:Smith JD et al 2016. PMID 26956608; Vector Backbone:pRS414; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA Binding Coordinates: chrII: 213734-213753 (- strand) This is a yeast integration plasmid, and should be linearized with BstZ17I (or elsewhere within the TRP1 gene) before transformation for integration into Chromosome V of the yeast genome
Proper citation: RRID:Addgene_166075 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Promoter of RRT8
Vector Backbone Description: Backbone Marker:Smith JD et al 2016. PMID 26956608; Vector Backbone:pRS414; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA Binding Coordinates: chrXV:241445..241464 (-strand) This is a yeast integration plasmid, and should be linearized with BstZ17I (or elsewhere within the TRP1 gene) before transformation for integration into Chromosome V of the yeast genome
Proper citation: RRID:Addgene_166080 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Msn2-sgRNA#27
Vector Backbone Description: Vector Backbone:pYTK101; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_166103 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MAT Z1
Vector Backbone Description: Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t, Daran Lab; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_166100 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Msn2-sgRNA#27
Vector Backbone Description: Vector Backbone:pYTK103; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_166105 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Murine polyomavirus deltaVP1 (NLS deletion mutant)
Vector Backbone Description: Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34591448
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.01.30.428974v1 for BioRxiv preprint
Proper citation: RRID:Addgene_166675 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VAC8
Vector Backbone Description: Vector Backbone:pRS405; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32508216
Comments: Linearize with AflII
Proper citation: RRID:Addgene_166838 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ATG5 ATG12 ATG16
Vector Backbone Description: Vector Backbone:pRS416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26812546
Proper citation: RRID:Addgene_166851 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Atg13[571–700]
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31352862
Proper citation: RRID:Addgene_166855 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.