Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:drosophila melanogaster (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

443,799 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pMT-NTAP-DmDCP1_K
 
Resource Report
Resource Website
RRID:Addgene_146735 DmDCP1 Drosophila melanogaster Ampicillin pMK33-NTAP and pMK33-CTAP vectors are designed for making proteinfusions tagged with the TAP tag and for generating stableDrosophila cell lines under Hygromycin selection. TAP fusions areinducible with copper sulfate. The parental vector, pMK33 (pMt/Hy),was created by Michael Koelle. Sequence based on the sequence given by NCBI: gi: 22026940. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:pMK33-NTAP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:28 0
pAc5.1B-HA-DmDCP1-R57D-dsRNAres_Q
 
Resource Report
Resource Website
RRID:Addgene_147268 DmDCP1-R57D-dsRNAres Drosophila melanogaster Ampicillin ORF extracted from NCBI: NM_137998.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:28 0
pAc5.1B-HA-DmDCP1-F36A-dsRNAres_Q
 
Resource Report
Resource Website
RRID:Addgene_147266 DmDCP1-F36A-dsRNAres Drosophila melanogaster Ampicillin ORF extracted from NCBI: NM_137998.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:29 0
pAc5.1B-HA-DmDCP1-R96AS100A-dsRNAres_Q
 
Resource Report
Resource Website
RRID:Addgene_147270 DmDCP1-R96AS100A-dsRNAres Drosophila melanogaster Ampicillin ORF extracted from NCBI: NM_137998.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:28 0
pAc5.1B-myc-SBP-DmDCP2-E361A-dsRNAres_J
 
Resource Report
Resource Website
RRID:Addgene_146630 DmDCP2-E361A-dsRNAres Drosophila melanogaster Ampicillin sequence given by NCBI: NM_140548.3 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:29 0
pnEA-NvG-DmDCP1_1-127_N
 
Resource Report
Resource Website
RRID:Addgene_147050 DmDCP1_1-127 Drosophila melanogaster Ampicillin PMID:23142987 Sequence based on the sequence given by NCBI: gi: 22026940. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:29 0
Donor_N_FH_Shu
 
Resource Report
Resource Website
RRID:Addgene_186655 OSS Shu N-terminal 3xFlag-3xHA Tag Donor Plasmid Drosophila melanogaster Ampicillin PMID:35639929 Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:32 0
piwi_sgRNA
 
Resource Report
Resource Website
RRID:Addgene_186653 Piwi sgRNA Plasmid Drosophila melanogaster Ampicillin PMID:35639929 sgRNA sequenceGCGAGTGCCAAAAAGTAACAA, The corresponding genome sequence is: GCGAGTGCCAAAAAGTAACA. Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint. Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:32 0
GLE_sgRNA
 
Resource Report
Resource Website
RRID:Addgene_186658 Gle sgRNA Plasmid Drosophila melanogaster Ampicillin PMID:35639929 sgRNA sequence: GCGTATCCCCTTAACAATAA. The corresponding genome sequence is: CCGTATCCCCTTAACAATAA. Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint. Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:31 0
pBABR IRFP-Bcd-LEXY
 
Resource Report
Resource Website
RRID:Addgene_182595 Bcd Drosophila melanogaster Ampicillin PMID:35320726 Vector Backbone:pBABR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:36 0
YFP Rab4
 
Resource Report
Resource Website
RRID:Addgene_99018 Rab4 Drosophila melanogaster Ampicillin PMID:29937389 YFP Rab4 from Addgene 37690 was transferred to pcDNA3.1 Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:22:42 0
YFP Rab4DN
 
Resource Report
Resource Website
RRID:Addgene_99019 Rab4 DN Drosophila melanogaster Ampicillin PMID:29937389 YFP Rab4DN from Addgene 37691 was transferred to pcDNA3.1 Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S22N Dominant negative 2026-08-15 01:22:42 0
pAc5.1B-EGFP-DmCup-Y342AL347A_O
 
Resource Report
Resource Website
RRID:Addgene_147103 DmCup-Y342AL347A Drosophila melanogaster Ampicillin PMID:25179781 Sequence according to the sequence given by NCBI: AF004917.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Y342A, L347A, I350L, P418S, K1045N 2026-08-15 01:22:55 0
pAc5.1B-lambdaN-HA-DmGW182-delCterm_E
 
Resource Report
Resource Website
RRID:Addgene_146252 DmGW182-delC-term Drosophila melanogaster Ampicillin PMID:19383769 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin V758A, Q817R, and N853S 2026-08-15 01:22:55 0
pAc5.1A-DmXRN1-D207A-dsRNAres-V5His6_O
 
Resource Report
Resource Website
RRID:Addgene_147065 DmXRN1-D207A-dsRNAres Drosophila melanogaster Ampicillin Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin one silent mtuation compared to the sequence given by NCBI:NM_078684 variant A 2026-08-15 01:22:55 0
pAc5.1B-lambdaN-HA-DmNot1_1710-2505_J
 
Resource Report
Resource Website
RRID:Addgene_146702 DmNot1_1710-2505 Drosophila melanogaster Ampicillin PMID:24768540 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin two non silent mutations (A1747T, G1999S) and one silent mutation compared to the sequence given by NCBI: NM_001103772.2 2026-08-15 01:22:55 0
pAc5.1B-lambdaN-HA-DmNot3-dsRNAres_Q
 
Resource Report
Resource Website
RRID:Addgene_147279 DmNot3-dsRNAres Drosophila melanogaster Ampicillin Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin one silent mutation compared to the sequence given by NCBI: NM_136332.2. 2026-08-15 01:22:55 0
pAc5.1B-EGFP-Dm4E-T-L36AL39A_T
 
Resource Report
Resource Website
RRID:Addgene_147604 Dm4E-T-L36AL39A Drosophila melanogaster Ampicillin PMID:25179781 ORF extracted from CG32016 isoform C. NCBI:NM_166798.1, one variation L127S annotated as EST. Please note that the Addgene verified sequence may be slightly different compared to the depositor's reference sequences. These differences do not affect plasmid function. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Two non silent mutations (H628R and N659S) compared to the sequence given by NCBI: NM_166798.1. 2026-08-15 01:22:55 0
pAc5.1B-EGFP-DmCaf40-A253FY208A_X
 
Resource Report
Resource Website
RRID:Addgene_147973 DmCaf40-A253FY208A Drosophila melanogaster Ampicillin PMID:24768540 ORF extracted from NCBI:NM_167675.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:22:57 0
pAc5.1B-lambdaN-HA-Dm4E-T_1-511-LLFWKtoAAAAA-V5His6_Z
 
Resource Report
Resource Website
RRID:Addgene_148160 Dm4E-T_1-511-LLFWKtoAAAAA Drosophila melanogaster Ampicillin PMID:25179781 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin alias: 4E-T; one non silent mutation L127S, annotated as EST compared to CG32016 isoform C. NCBI:NM_166798.1. 2026-08-15 01:22:57 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.