Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pMT-NTAP-DmDCP1_K Resource Report Resource Website |
RRID:Addgene_146735 | DmDCP1 | Drosophila melanogaster | Ampicillin | pMK33-NTAP and pMK33-CTAP vectors are designed for making proteinfusions tagged with the TAP tag and for generating stableDrosophila cell lines under Hygromycin selection. TAP fusions areinducible with copper sulfate. The parental vector, pMK33 (pMt/Hy),was created by Michael Koelle. Sequence based on the sequence given by NCBI: gi: 22026940. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:pMK33-NTAP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:28 | 0 | ||
|
pAc5.1B-HA-DmDCP1-R57D-dsRNAres_Q Resource Report Resource Website |
RRID:Addgene_147268 | DmDCP1-R57D-dsRNAres | Drosophila melanogaster | Ampicillin | ORF extracted from NCBI: NM_137998.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:28 | 0 | ||
|
pAc5.1B-HA-DmDCP1-F36A-dsRNAres_Q Resource Report Resource Website |
RRID:Addgene_147266 | DmDCP1-F36A-dsRNAres | Drosophila melanogaster | Ampicillin | ORF extracted from NCBI: NM_137998.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:29 | 0 | ||
|
pAc5.1B-HA-DmDCP1-R96AS100A-dsRNAres_Q Resource Report Resource Website |
RRID:Addgene_147270 | DmDCP1-R96AS100A-dsRNAres | Drosophila melanogaster | Ampicillin | ORF extracted from NCBI: NM_137998.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:28 | 0 | ||
|
pAc5.1B-myc-SBP-DmDCP2-E361A-dsRNAres_J Resource Report Resource Website |
RRID:Addgene_146630 | DmDCP2-E361A-dsRNAres | Drosophila melanogaster | Ampicillin | sequence given by NCBI: NM_140548.3 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:29 | 0 | ||
|
pnEA-NvG-DmDCP1_1-127_N Resource Report Resource Website |
RRID:Addgene_147050 | DmDCP1_1-127 | Drosophila melanogaster | Ampicillin | PMID:23142987 | Sequence based on the sequence given by NCBI: gi: 22026940. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:29 | 0 | |
|
Donor_N_FH_Shu Resource Report Resource Website |
RRID:Addgene_186655 | OSS Shu N-terminal 3xFlag-3xHA Tag Donor Plasmid | Drosophila melanogaster | Ampicillin | PMID:35639929 | Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint. | Vector Backbone:pUC19; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:32 | 0 | |
|
piwi_sgRNA Resource Report Resource Website |
RRID:Addgene_186653 | Piwi sgRNA Plasmid | Drosophila melanogaster | Ampicillin | PMID:35639929 | sgRNA sequenceGCGAGTGCCAAAAAGTAACAA, The corresponding genome sequence is: GCGAGTGCCAAAAAGTAACA. Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint. | Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:32 | 0 | |
|
GLE_sgRNA Resource Report Resource Website |
RRID:Addgene_186658 | Gle sgRNA Plasmid | Drosophila melanogaster | Ampicillin | PMID:35639929 | sgRNA sequence: GCGTATCCCCTTAACAATAA. The corresponding genome sequence is: CCGTATCCCCTTAACAATAA. Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint. | Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:31 | 0 | |
|
pBABR IRFP-Bcd-LEXY Resource Report Resource Website |
RRID:Addgene_182595 | Bcd | Drosophila melanogaster | Ampicillin | PMID:35320726 | Vector Backbone:pBABR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:36 | 0 | ||
|
YFP Rab4 Resource Report Resource Website |
RRID:Addgene_99018 | Rab4 | Drosophila melanogaster | Ampicillin | PMID:29937389 | YFP Rab4 from Addgene 37690 was transferred to pcDNA3.1 | Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:42 | 0 | |
|
YFP Rab4DN Resource Report Resource Website |
RRID:Addgene_99019 | Rab4 DN | Drosophila melanogaster | Ampicillin | PMID:29937389 | YFP Rab4DN from Addgene 37691 was transferred to pcDNA3.1 | Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S22N Dominant negative | 2026-08-15 01:22:42 | 0 |
|
pAc5.1B-EGFP-DmCup-Y342AL347A_O Resource Report Resource Website |
RRID:Addgene_147103 | DmCup-Y342AL347A | Drosophila melanogaster | Ampicillin | PMID:25179781 | Sequence according to the sequence given by NCBI: AF004917.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Y342A, L347A, I350L, P418S, K1045N | 2026-08-15 01:22:55 | 0 |
|
pAc5.1B-lambdaN-HA-DmGW182-delCterm_E Resource Report Resource Website |
RRID:Addgene_146252 | DmGW182-delC-term | Drosophila melanogaster | Ampicillin | PMID:19383769 | Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | V758A, Q817R, and N853S | 2026-08-15 01:22:55 | 0 |
|
pAc5.1A-DmXRN1-D207A-dsRNAres-V5His6_O Resource Report Resource Website |
RRID:Addgene_147065 | DmXRN1-D207A-dsRNAres | Drosophila melanogaster | Ampicillin | Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | one silent mtuation compared to the sequence given by NCBI:NM_078684 variant A | 2026-08-15 01:22:55 | 0 | |
|
pAc5.1B-lambdaN-HA-DmNot1_1710-2505_J Resource Report Resource Website |
RRID:Addgene_146702 | DmNot1_1710-2505 | Drosophila melanogaster | Ampicillin | PMID:24768540 | Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | two non silent mutations (A1747T, G1999S) and one silent mutation compared to the sequence given by NCBI: NM_001103772.2 | 2026-08-15 01:22:55 | 0 |
|
pAc5.1B-lambdaN-HA-DmNot3-dsRNAres_Q Resource Report Resource Website |
RRID:Addgene_147279 | DmNot3-dsRNAres | Drosophila melanogaster | Ampicillin | Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | one silent mutation compared to the sequence given by NCBI: NM_136332.2. | 2026-08-15 01:22:55 | 0 | |
|
pAc5.1B-EGFP-Dm4E-T-L36AL39A_T Resource Report Resource Website |
RRID:Addgene_147604 | Dm4E-T-L36AL39A | Drosophila melanogaster | Ampicillin | PMID:25179781 | ORF extracted from CG32016 isoform C. NCBI:NM_166798.1, one variation L127S annotated as EST. Please note that the Addgene verified sequence may be slightly different compared to the depositor's reference sequences. These differences do not affect plasmid function. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Two non silent mutations (H628R and N659S) compared to the sequence given by NCBI: NM_166798.1. | 2026-08-15 01:22:55 | 0 |
|
pAc5.1B-EGFP-DmCaf40-A253FY208A_X Resource Report Resource Website |
RRID:Addgene_147973 | DmCaf40-A253FY208A | Drosophila melanogaster | Ampicillin | PMID:24768540 | ORF extracted from NCBI:NM_167675.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:57 | 0 | |
|
pAc5.1B-lambdaN-HA-Dm4E-T_1-511-LLFWKtoAAAAA-V5His6_Z Resource Report Resource Website |
RRID:Addgene_148160 | Dm4E-T_1-511-LLFWKtoAAAAA | Drosophila melanogaster | Ampicillin | PMID:25179781 | Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | alias: 4E-T; one non silent mutation L127S, annotated as EST compared to CG32016 isoform C. NCBI:NM_166798.1. | 2026-08-15 01:22:57 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.