Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Pmyo-3::hpo-30 gDNA (pBAB204) Resource Report Resource Website |
RRID:Addgene_117385 | genomic DNA of hpo-30 (833 bp) | Caenorhabditis elegans | Ampicillin | PMID:29950505 | Backbone Size:3410; Vector Backbone:pPD49.26; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 | ||
|
3xHA-TurboID_pAS31 Resource Report Resource Website 1+ mentions |
RRID:Addgene_118220 | TurboID (BirA mutant) | Caenorhabditis elegans | Ampicillin | PMID:30125270 | Please see depositor's annotated sequence in the Supplemental Documents section above. Note that there are minor differences between the Addgene verified sequence and depositor's reference sequence which do not affect plasmid function. | Backbone Size:6957; Vector Backbone:Bluescript; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | Q65P, I87V, R118S, E140K, Q141R, S150G, L151P, V160A, T192A, K194I, M209V, M241T, S263P, I305V | 2026-08-15 01:03:01 | 4 |
|
3xHA-miniTurbo_pAS32 Resource Report Resource Website |
RRID:Addgene_118222 | miniTurbo (BirA mutant) | Caenorhabditis elegans | Ampicillin | PMID:30125270 | Backbone Size:6954; Vector Backbone:Bluescript; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | aa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, S150G, L151P, V160A, T192A, K194I, M209V, I305V | 2026-08-15 01:03:01 | 0 | |
|
pJW4.13 Resource Report Resource Website |
RRID:Addgene_131375 | pptr-2 | Caenorhabditis elegans | Ampicillin | PMID:25535836 | Backbone Marker:Jason Pellettieri ; Backbone Size:8356; Vector Backbone:pMAL-c2X (MBP fusion); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:17 | 0 | ||
|
pJW4.15 Resource Report Resource Website |
RRID:Addgene_131373 | paa-1 | Caenorhabditis elegans | Ampicillin | PMID:25535836 | Backbone Marker:Jason Pellettieri ; Backbone Size:8356; Vector Backbone:pMAL-c2X (MBP fusion); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:17 | 0 | ||
|
pJW4.33 Resource Report Resource Website |
RRID:Addgene_131369 | meg-3 | Caenorhabditis elegans | Ampicillin | PMID:25535836 | Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX6p1 (GST-fusion); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:17 | 0 | ||
|
pDC20 Resource Report Resource Website |
RRID:Addgene_131366 | meg-3 (aa1-862) | Caenorhabditis elegans | Kanamycin | PMID:27914198 | Vector Backbone:pet28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:05:17 | 0 | ||
|
Myo 9 Avi+Flag Resource Report Resource Website |
RRID:Addgene_134969 | Myo 9 | Caenorhabditis elegans | Ampicillin | PMID:20538589 | Sequencing of the C. elegans Myo9 cDNA that was obtained by reverse transcription-PCR revealed that it differed from the HUM-7 amino acid sequence at two positions. Residues 608–615 (VSPISPFW) were missing, and residues 731KKSAG735 were replaced by 731KSESAG736. Our deduced Myo9 amino acid sequence changes matched perfectly with the predicted Myo9 sequences for Caenorhabditis briggsae and Caenorhabditis remanei. | Backbone Marker:Invitrogen; Backbone Size:4673; Vector Backbone:pFast Bac 1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:50 | 0 | |
|
pCZGY921 Resource Report Resource Website |
RRID:Addgene_135092 | Pacr-2 | Caenorhabditis elegans | Ampicillin | PMID:20027209 | Backbone Marker:Invitrogen Gateway; Backbone Size:4500; Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:51 | 0 | ||
|
pCZGY2750 Resource Report Resource Website 1+ mentions |
RRID:Addgene_135094 | sgRNA for cxTi10082 (actgttggatgcctgtgtag) | Caenorhabditis elegans | Ampicillin | PMID:31378567 | Backbone Marker:Goldstein Lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:50 | 2 | ||
|
pCZGY1584 Pcol-19::ebp-2::mGFP::unc-54 3'UTR Resource Report Resource Website |
RRID:Addgene_129774 | Pcol-19 | Caenorhabditis elegans | Ampicillin | PMID:27661253 | Please note: The plasmid region containing col-19 promoter and 5' synthetic intron are in the opposite orientation in the plasmid compared to the depositor's sequence. This is not known to be a concern for plasmid function. | Backbone Marker:Invitrogen Gateway; Backbone Size:2500; Vector Backbone:pDEST; Vector Types:Worm Expression, Gateway Cloning, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:01 | 0 | |
|
pJS263 Resource Report Resource Website |
RRID:Addgene_134141 | Ska1 MTBD-His | Caenorhabditis elegans | Ampicillin | PMID:29153323 | Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:41 | 0 | ||
|
pDK540 Resource Report Resource Website |
RRID:Addgene_134201 | KNL1 FL with YA mutant | Caenorhabditis elegans | Ampicillin | PMID:25411336 | Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | YA | 2026-08-15 01:05:42 | 0 | |
|
pDK038 Resource Report Resource Website |
RRID:Addgene_134182 | KNL1 aa 69-235 | Caenorhabditis elegans | Ampicillin | PMID:25411336 | Vector Backbone:pRSETa; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:42 | 0 | ||
|
pDK134 Resource Report Resource Website |
RRID:Addgene_134187 | KNL1 aa 69 - 479 | Caenorhabditis elegans | Ampicillin | PMID:25411336 | Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:42 | 0 | ||
|
pDK167 Resource Report Resource Website |
RRID:Addgene_134188 | KNL1 FL with oligomutant | Caenorhabditis elegans | Ampicillin | PMID:25411336 | Vector Backbone:pIC115_4; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:42 | 0 | ||
|
pDK324 Resource Report Resource Website |
RRID:Addgene_134190 | KNL1 | Caenorhabditis elegans | Ampicillin | Vector Backbone:pRSETa; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 8A | 2026-08-15 01:05:42 | 0 | ||
|
pCAGGS EFF-1::V5 Resource Report Resource Website |
RRID:Addgene_133584 | EFF-1::V5 | Caenorhabditis elegans | Ampicillin | PMID:21436398 | Backbone Size:4741; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:05:37 | 0 | ||
|
pHCMM4 Resource Report Resource Website |
RRID:Addgene_170359 | PCYC1_SEC61_mCherry_LEU2_TCYC1 | Caenorhabditis elegans | Ampicillin | PMID:32907940 | Backbone Size:4872; Vector Backbone:NA; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:08 | 0 | ||
|
pAAP20 Resource Report Resource Website |
RRID:Addgene_171206 | meg-3 | Caenorhabditis elegans | Kanamycin | Please visit https://www.biorxiv.org/content/10.1101/2020.10.15.340570v1 for bioRxiv preprint. | Vector Backbone:pet28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | aa545-862 | 2026-08-15 01:10:15 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.