Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:caenorhabditis elegans (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,881 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
Pmyo-3::hpo-30 gDNA (pBAB204)
 
Resource Report
Resource Website
RRID:Addgene_117385 genomic DNA of hpo-30 (833 bp) Caenorhabditis elegans Ampicillin PMID:29950505 Backbone Size:3410; Vector Backbone:pPD49.26; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0
3xHA-TurboID_pAS31
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_118220 TurboID (BirA mutant) Caenorhabditis elegans Ampicillin PMID:30125270 Please see depositor's annotated sequence in the Supplemental Documents section above. Note that there are minor differences between the Addgene verified sequence and depositor's reference sequence which do not affect plasmid function. Backbone Size:6957; Vector Backbone:Bluescript; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin Q65P, I87V, R118S, E140K, Q141R, S150G, L151P, V160A, T192A, K194I, M209V, M241T, S263P, I305V 2026-08-15 01:03:01 4
3xHA-miniTurbo_pAS32
 
Resource Report
Resource Website
RRID:Addgene_118222 miniTurbo (BirA mutant) Caenorhabditis elegans Ampicillin PMID:30125270 Backbone Size:6954; Vector Backbone:Bluescript; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin aa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, S150G, L151P, V160A, T192A, K194I, M209V, I305V 2026-08-15 01:03:01 0
pJW4.13
 
Resource Report
Resource Website
RRID:Addgene_131375 pptr-2 Caenorhabditis elegans Ampicillin PMID:25535836 Backbone Marker:Jason Pellettieri ; Backbone Size:8356; Vector Backbone:pMAL-c2X (MBP fusion); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:17 0
pJW4.15
 
Resource Report
Resource Website
RRID:Addgene_131373 paa-1 Caenorhabditis elegans Ampicillin PMID:25535836 Backbone Marker:Jason Pellettieri ; Backbone Size:8356; Vector Backbone:pMAL-c2X (MBP fusion); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:17 0
pJW4.33
 
Resource Report
Resource Website
RRID:Addgene_131369 meg-3 Caenorhabditis elegans Ampicillin PMID:25535836 Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX6p1 (GST-fusion); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:17 0
pDC20
 
Resource Report
Resource Website
RRID:Addgene_131366 meg-3 (aa1-862) Caenorhabditis elegans Kanamycin PMID:27914198 Vector Backbone:pet28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:05:17 0
Myo 9 Avi+Flag
 
Resource Report
Resource Website
RRID:Addgene_134969 Myo 9 Caenorhabditis elegans Ampicillin PMID:20538589 Sequencing of the C. elegans Myo9 cDNA that was obtained by reverse transcription-PCR revealed that it differed from the HUM-7 amino acid sequence at two positions. Residues 608–615 (VSPISPFW) were missing, and residues 731KKSAG735 were replaced by 731KSESAG736. Our deduced Myo9 amino acid sequence changes matched perfectly with the predicted Myo9 sequences for Caenorhabditis briggsae and Caenorhabditis remanei. Backbone Marker:Invitrogen; Backbone Size:4673; Vector Backbone:pFast Bac 1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:50 0
pCZGY921
 
Resource Report
Resource Website
RRID:Addgene_135092 Pacr-2 Caenorhabditis elegans Ampicillin PMID:20027209 Backbone Marker:Invitrogen Gateway; Backbone Size:4500; Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:51 0
pCZGY2750
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_135094 sgRNA for cxTi10082 (actgttggatgcctgtgtag) Caenorhabditis elegans Ampicillin PMID:31378567 Backbone Marker:Goldstein Lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:05:50 2
pCZGY1584 Pcol-19::ebp-2::mGFP::unc-54 3'UTR
 
Resource Report
Resource Website
RRID:Addgene_129774 Pcol-19 Caenorhabditis elegans Ampicillin PMID:27661253 Please note: The plasmid region containing col-19 promoter and 5' synthetic intron are in the opposite orientation in the plasmid compared to the depositor's sequence. This is not known to be a concern for plasmid function. Backbone Marker:Invitrogen Gateway; Backbone Size:2500; Vector Backbone:pDEST; Vector Types:Worm Expression, Gateway Cloning, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:05:01 0
pJS263
 
Resource Report
Resource Website
RRID:Addgene_134141 Ska1 MTBD-His Caenorhabditis elegans Ampicillin PMID:29153323 Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:41 0
pDK540
 
Resource Report
Resource Website
RRID:Addgene_134201 KNL1 FL with YA mutant Caenorhabditis elegans Ampicillin PMID:25411336 Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin YA 2026-08-15 01:05:42 0
pDK038
 
Resource Report
Resource Website
RRID:Addgene_134182 KNL1 aa 69-235 Caenorhabditis elegans Ampicillin PMID:25411336 Vector Backbone:pRSETa; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:42 0
pDK134
 
Resource Report
Resource Website
RRID:Addgene_134187 KNL1 aa 69 - 479 Caenorhabditis elegans Ampicillin PMID:25411336 Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:42 0
pDK167
 
Resource Report
Resource Website
RRID:Addgene_134188 KNL1 FL with oligomutant Caenorhabditis elegans Ampicillin PMID:25411336 Vector Backbone:pIC115_4; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:42 0
pDK324
 
Resource Report
Resource Website
RRID:Addgene_134190 KNL1 Caenorhabditis elegans Ampicillin Vector Backbone:pRSETa; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 8A 2026-08-15 01:05:42 0
pCAGGS EFF-1::V5
 
Resource Report
Resource Website
RRID:Addgene_133584 EFF-1::V5 Caenorhabditis elegans Ampicillin PMID:21436398 Backbone Size:4741; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:37 0
pHCMM4
 
Resource Report
Resource Website
RRID:Addgene_170359 PCYC1_SEC61_mCherry_LEU2_TCYC1 Caenorhabditis elegans Ampicillin PMID:32907940 Backbone Size:4872; Vector Backbone:NA; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:10:08 0
pAAP20
 
Resource Report
Resource Website
RRID:Addgene_171206 meg-3 Caenorhabditis elegans Kanamycin Please visit https://www.biorxiv.org/content/10.1101/2020.10.15.340570v1 for bioRxiv preprint. Vector Backbone:pet28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin aa545-862 2026-08-15 01:10:15 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.