Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 53 showing 1041 ~ 1060 out of 1,881 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/117385

Species: Caenorhabditis elegans
Genetic Insert: genomic DNA of hpo-30 (833 bp)
Vector Backbone Description: Backbone Size:3410; Vector Backbone:pPD49.26; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29950505

Proper citation: RRID:Addgene_117385 Copy   


  • RRID:Addgene_118220

    This resource has 1+ mentions.

http://www.addgene.org/118220

Species: Caenorhabditis elegans
Genetic Insert: TurboID (BirA mutant)
Vector Backbone Description: Backbone Size:6957; Vector Backbone:Bluescript; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30125270
Comments: Please see depositor's annotated sequence in the Supplemental Documents section above. Note that there are minor differences between the Addgene verified sequence and depositor's reference sequence which do not affect plasmid function.

Proper citation: RRID:Addgene_118220 Copy   


  • RRID:Addgene_118222

http://www.addgene.org/118222

Species: Caenorhabditis elegans
Genetic Insert: miniTurbo (BirA mutant)
Vector Backbone Description: Backbone Size:6954; Vector Backbone:Bluescript; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30125270

Proper citation: RRID:Addgene_118222 Copy   


  • RRID:Addgene_131375

http://www.addgene.org/131375

Species: Caenorhabditis elegans
Genetic Insert: pptr-2
Vector Backbone Description: Backbone Marker:Jason Pellettieri ; Backbone Size:8356; Vector Backbone:pMAL-c2X (MBP fusion); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535836

Proper citation: RRID:Addgene_131375 Copy   


  • RRID:Addgene_131373

http://www.addgene.org/131373

Species: Caenorhabditis elegans
Genetic Insert: paa-1
Vector Backbone Description: Backbone Marker:Jason Pellettieri ; Backbone Size:8356; Vector Backbone:pMAL-c2X (MBP fusion); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535836

Proper citation: RRID:Addgene_131373 Copy   


  • RRID:Addgene_131369

http://www.addgene.org/131369

Species: Caenorhabditis elegans
Genetic Insert: meg-3
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX6p1 (GST-fusion); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535836

Proper citation: RRID:Addgene_131369 Copy   


  • RRID:Addgene_131366

http://www.addgene.org/131366

Species: Caenorhabditis elegans
Genetic Insert: meg-3 (aa1-862)
Vector Backbone Description: Vector Backbone:pet28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27914198

Proper citation: RRID:Addgene_131366 Copy   


  • RRID:Addgene_134969

http://www.addgene.org/134969

Species: Caenorhabditis elegans
Genetic Insert: Myo 9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4673; Vector Backbone:pFast Bac 1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20538589
Comments: Sequencing of the C. elegans Myo9 cDNA that was obtained by reverse transcription-PCR revealed that it differed from the HUM-7 amino acid sequence at two positions. Residues 608–615 (VSPISPFW) were missing, and residues 731KKSAG735 were replaced by 731KSESAG736. Our deduced Myo9 amino acid sequence changes matched perfectly with the predicted Myo9 sequences for Caenorhabditis briggsae and Caenorhabditis remanei.

Proper citation: RRID:Addgene_134969 Copy   


  • RRID:Addgene_135092

http://www.addgene.org/135092

Species: Caenorhabditis elegans
Genetic Insert: Pacr-2
Vector Backbone Description: Backbone Marker:Invitrogen Gateway; Backbone Size:4500; Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20027209

Proper citation: RRID:Addgene_135092 Copy   


  • RRID:Addgene_135094

    This resource has 1+ mentions.

http://www.addgene.org/135094

Species: Caenorhabditis elegans
Genetic Insert: sgRNA for cxTi10082 (actgttggatgcctgtgtag)
Vector Backbone Description: Backbone Marker:Goldstein Lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31378567

Proper citation: RRID:Addgene_135094 Copy   


http://www.addgene.org/129774

Species: Caenorhabditis elegans
Genetic Insert: Pcol-19
Vector Backbone Description: Backbone Marker:Invitrogen Gateway; Backbone Size:2500; Vector Backbone:pDEST; Vector Types:Worm Expression, Gateway Cloning, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27661253
Comments: Please note: The plasmid region containing col-19 promoter and 5' synthetic intron are in the opposite orientation in the plasmid compared to the depositor's sequence. This is not known to be a concern for plasmid function.

Proper citation: RRID:Addgene_129774 Copy   


  • RRID:Addgene_134141

http://www.addgene.org/134141

Species: Caenorhabditis elegans
Genetic Insert: Ska1 MTBD-His
Vector Backbone Description: Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29153323

Proper citation: RRID:Addgene_134141 Copy   


  • RRID:Addgene_134201

http://www.addgene.org/134201

Species: Caenorhabditis elegans
Genetic Insert: KNL1 FL with YA mutant
Vector Backbone Description: Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25411336

Proper citation: RRID:Addgene_134201 Copy   


  • RRID:Addgene_134182

http://www.addgene.org/134182

Species: Caenorhabditis elegans
Genetic Insert: KNL1 aa 69-235
Vector Backbone Description: Vector Backbone:pRSETa; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25411336

Proper citation: RRID:Addgene_134182 Copy   


  • RRID:Addgene_134187

http://www.addgene.org/134187

Species: Caenorhabditis elegans
Genetic Insert: KNL1 aa 69 - 479
Vector Backbone Description: Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25411336

Proper citation: RRID:Addgene_134187 Copy   


  • RRID:Addgene_134188

http://www.addgene.org/134188

Species: Caenorhabditis elegans
Genetic Insert: KNL1 FL with oligomutant
Vector Backbone Description: Vector Backbone:pIC115_4; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25411336

Proper citation: RRID:Addgene_134188 Copy   


  • RRID:Addgene_134190

http://www.addgene.org/134190

Species: Caenorhabditis elegans
Genetic Insert: KNL1
Vector Backbone Description: Vector Backbone:pRSETa; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_134190 Copy   


  • RRID:Addgene_133584

http://www.addgene.org/133584

Species: Caenorhabditis elegans
Genetic Insert: EFF-1::V5
Vector Backbone Description: Backbone Size:4741; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21436398

Proper citation: RRID:Addgene_133584 Copy   


  • RRID:Addgene_170359

http://www.addgene.org/170359

Species: Caenorhabditis elegans
Genetic Insert: PCYC1_SEC61_mCherry_LEU2_TCYC1
Vector Backbone Description: Backbone Size:4872; Vector Backbone:NA; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32907940

Proper citation: RRID:Addgene_170359 Copy   


  • RRID:Addgene_171206

http://www.addgene.org/171206

Species: Caenorhabditis elegans
Genetic Insert: meg-3
Vector Backbone Description: Vector Backbone:pet28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.10.15.340570v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_171206 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X