Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Drosophila melanogaster
Genetic Insert: DmDCP1
Vector Backbone Description: Vector Backbone:pMK33-NTAP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: pMK33-NTAP and pMK33-CTAP vectors are designed for making proteinfusions tagged with the TAP tag and for generating stableDrosophila cell lines under Hygromycin selection. TAP fusions areinducible with copper sulfate. The parental vector, pMK33 (pMt/Hy),was created by Michael Koelle. Sequence based on the sequence given by NCBI: gi: 22026940. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_146735 Copy
Species: Drosophila melanogaster
Genetic Insert: DmDCP1-R57D-dsRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: ORF extracted from NCBI: NM_137998.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147268 Copy
Species: Drosophila melanogaster
Genetic Insert: DmDCP1-F36A-dsRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: ORF extracted from NCBI: NM_137998.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147266 Copy
Species: Drosophila melanogaster
Genetic Insert: DmDCP1-R96AS100A-dsRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: ORF extracted from NCBI: NM_137998.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147270 Copy
Species: Drosophila melanogaster
Genetic Insert: DmDCP2-E361A-dsRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: sequence given by NCBI: NM_140548.3 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_146630 Copy
Species: Drosophila melanogaster
Genetic Insert: DmDCP1_1-127
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23142987
Comments: Sequence based on the sequence given by NCBI: gi: 22026940. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147050 Copy
Species: Drosophila melanogaster
Genetic Insert: OSS Shu N-terminal 3xFlag-3xHA Tag Donor Plasmid
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35639929
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_186655 Copy
Species: Drosophila melanogaster
Genetic Insert: Piwi sgRNA Plasmid
Vector Backbone Description: Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35639929
Comments: sgRNA sequenceGCGAGTGCCAAAAAGTAACAA, The corresponding genome sequence is: GCGAGTGCCAAAAAGTAACA.
Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_186653 Copy
Species: Drosophila melanogaster
Genetic Insert: Gle sgRNA Plasmid
Vector Backbone Description: Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35639929
Comments: sgRNA sequence: GCGTATCCCCTTAACAATAA. The corresponding genome sequence is: CCGTATCCCCTTAACAATAA.
Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_186658 Copy
Species: Drosophila melanogaster
Genetic Insert: Bcd
Vector Backbone Description: Vector Backbone:pBABR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35320726
Proper citation: RRID:Addgene_182595 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab4
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29937389
Comments: YFP Rab4 from Addgene 37690 was transferred to pcDNA3.1
Proper citation: RRID:Addgene_99018 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab4 DN
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29937389
Comments: YFP Rab4DN from Addgene 37691 was transferred to pcDNA3.1
Proper citation: RRID:Addgene_99019 Copy
Species: Drosophila melanogaster
Genetic Insert: DmCup-Y342AL347A
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25179781
Comments: Sequence according to the sequence given by NCBI: AF004917.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147103 Copy
Species: Drosophila melanogaster
Genetic Insert: DmGW182-delC-term
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19383769
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_146252 Copy
Species: Drosophila melanogaster
Genetic Insert: DmXRN1-D207A-dsRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147065 Copy
Species: Drosophila melanogaster
Genetic Insert: DmNot1_1710-2505
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24768540
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_146702 Copy
Species: Drosophila melanogaster
Genetic Insert: DmNot3-dsRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147279 Copy
Species: Drosophila melanogaster
Genetic Insert: Dm4E-T-L36AL39A
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25179781
Comments: ORF extracted from CG32016 isoform C. NCBI:NM_166798.1, one variation L127S annotated as EST. Please note that the Addgene verified sequence may be slightly different compared to the depositor's reference sequences. These differences do not affect plasmid function. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147604 Copy
Species: Drosophila melanogaster
Genetic Insert: DmCaf40-A253FY208A
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24768540
Comments: ORF extracted from NCBI:NM_167675.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147973 Copy
Species: Drosophila melanogaster
Genetic Insert: Dm4E-T_1-511-LLFWKtoAAAAA
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25179781
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148160 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.