Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 53 showing 1041 ~ 1060 out of 443,799 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_146735

http://www.addgene.org/146735

Species: Drosophila melanogaster
Genetic Insert: DmDCP1
Vector Backbone Description: Vector Backbone:pMK33-NTAP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: pMK33-NTAP and pMK33-CTAP vectors are designed for making proteinfusions tagged with the TAP tag and for generating stableDrosophila cell lines under Hygromycin selection. TAP fusions areinducible with copper sulfate. The parental vector, pMK33 (pMt/Hy),was created by Michael Koelle. Sequence based on the sequence given by NCBI: gi: 22026940. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_146735 Copy   


http://www.addgene.org/147268

Species: Drosophila melanogaster
Genetic Insert: DmDCP1-R57D-dsRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: ORF extracted from NCBI: NM_137998.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147268 Copy   


http://www.addgene.org/147266

Species: Drosophila melanogaster
Genetic Insert: DmDCP1-F36A-dsRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: ORF extracted from NCBI: NM_137998.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147266 Copy   


http://www.addgene.org/147270

Species: Drosophila melanogaster
Genetic Insert: DmDCP1-R96AS100A-dsRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: ORF extracted from NCBI: NM_137998.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147270 Copy   


http://www.addgene.org/146630

Species: Drosophila melanogaster
Genetic Insert: DmDCP2-E361A-dsRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: sequence given by NCBI: NM_140548.3 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_146630 Copy   


http://www.addgene.org/147050

Species: Drosophila melanogaster
Genetic Insert: DmDCP1_1-127
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23142987
Comments: Sequence based on the sequence given by NCBI: gi: 22026940. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147050 Copy   


  • RRID:Addgene_186655

http://www.addgene.org/186655

Species: Drosophila melanogaster
Genetic Insert: OSS Shu N-terminal 3xFlag-3xHA Tag Donor Plasmid
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35639929
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_186655 Copy   


  • RRID:Addgene_186653

http://www.addgene.org/186653

Species: Drosophila melanogaster
Genetic Insert: Piwi sgRNA Plasmid
Vector Backbone Description: Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35639929
Comments: sgRNA sequenceGCGAGTGCCAAAAAGTAACAA, The corresponding genome sequence is: GCGAGTGCCAAAAAGTAACA. Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_186653 Copy   


  • RRID:Addgene_186658

http://www.addgene.org/186658

Species: Drosophila melanogaster
Genetic Insert: Gle sgRNA Plasmid
Vector Backbone Description: Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35639929
Comments: sgRNA sequence: GCGTATCCCCTTAACAATAA. The corresponding genome sequence is: CCGTATCCCCTTAACAATAA. Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_186658 Copy   


  • RRID:Addgene_182595

http://www.addgene.org/182595

Species: Drosophila melanogaster
Genetic Insert: Bcd
Vector Backbone Description: Vector Backbone:pBABR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35320726

Proper citation: RRID:Addgene_182595 Copy   


  • RRID:Addgene_99018

http://www.addgene.org/99018

Species: Drosophila melanogaster
Genetic Insert: Rab4
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29937389
Comments: YFP Rab4 from Addgene 37690 was transferred to pcDNA3.1

Proper citation: RRID:Addgene_99018 Copy   


  • RRID:Addgene_99019

http://www.addgene.org/99019

Species: Drosophila melanogaster
Genetic Insert: Rab4 DN
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29937389
Comments: YFP Rab4DN from Addgene 37691 was transferred to pcDNA3.1

Proper citation: RRID:Addgene_99019 Copy   


http://www.addgene.org/147103

Species: Drosophila melanogaster
Genetic Insert: DmCup-Y342AL347A
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25179781
Comments: Sequence according to the sequence given by NCBI: AF004917.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147103 Copy   


http://www.addgene.org/146252

Species: Drosophila melanogaster
Genetic Insert: DmGW182-delC-term
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19383769
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_146252 Copy   


http://www.addgene.org/147065

Species: Drosophila melanogaster
Genetic Insert: DmXRN1-D207A-dsRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147065 Copy   


http://www.addgene.org/146702

Species: Drosophila melanogaster
Genetic Insert: DmNot1_1710-2505
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24768540
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_146702 Copy   


http://www.addgene.org/147279

Species: Drosophila melanogaster
Genetic Insert: DmNot3-dsRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147279 Copy   


http://www.addgene.org/147604

Species: Drosophila melanogaster
Genetic Insert: Dm4E-T-L36AL39A
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25179781
Comments: ORF extracted from CG32016 isoform C. NCBI:NM_166798.1, one variation L127S annotated as EST. Please note that the Addgene verified sequence may be slightly different compared to the depositor's reference sequences. These differences do not affect plasmid function. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147604 Copy   


http://www.addgene.org/147973

Species: Drosophila melanogaster
Genetic Insert: DmCaf40-A253FY208A
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24768540
Comments: ORF extracted from NCBI:NM_167675.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147973 Copy   


http://www.addgene.org/148160

Species: Drosophila melanogaster
Genetic Insert: Dm4E-T_1-511-LLFWKtoAAAAA
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25179781
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_148160 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X