Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
PM-TD!TA Resource Report Resource Website |
RRID:Addgene_48655 | Bacterial TD crRNA to prototspacer A | Synthetic | Chloramphenicol | PMID:24076762 | Vector Backbone:p15A-cat; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:15:52 | 0 | ||
|
PM-ST1!TB Resource Report Resource Website |
RRID:Addgene_48654 | Bacterial ST1 crRNA to prototspacer B | Synthetic | Chloramphenicol | PMID:24076762 | Vector Backbone:p15A-cat; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:15:53 | 0 | ||
|
PM-SP!TA Resource Report Resource Website |
RRID:Addgene_48649 | Bacterial SP crRNA to prototspacer A | Synthetic | Chloramphenicol | PMID:24076762 | Vector Backbone:p15A-cat; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:15:52 | 0 | ||
|
pPy-CAG-GFP-IRES-Pac Resource Report Resource Website 1+ mentions |
RRID:Addgene_48759 | EGFP | Synthetic | Ampicillin | PMID:23582324 | Backbone Size:6600; Vector Backbone:Bluescript; Vector Types:Mammalian Expression, pPy; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:53 | 1 | ||
|
AmCyan-P2A-Xerry Resource Report Resource Website |
RRID:Addgene_48686 | AmCyan | Synthetic | Kanamycin | the nAmCyan and the mCherry genes are separated by a P2A sequence that results in 2 separate proteins. It also includes BsmBI restriction sites flanking the nAmCyan gene which result in BsiWI and BssHII overhangs for cloning in-frame with P2A-mCherry. | Backbone Marker:clontech; Backbone Size:4000; Vector Backbone:pmR-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | SV40 NLS | 2026-08-15 01:15:53 | 0 | |
|
M-tdTom-SP Resource Report Resource Website 1+ mentions |
RRID:Addgene_48677 | TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9 | Synthetic | Bleocin (Zeocin) | PMID:24076762 | Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:15:53 | 2 | ||
|
M-ST1-sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_48672 | sgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter | Synthetic | Kanamycin | PMID:24076762 | Backbone Marker:Invitrogen; Vector Backbone:pCR-BluntII-TOPO; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:52 | 4 | ||
|
SK-YFP-TD-A Resource Report Resource Website |
RRID:Addgene_48666 | TD prototspacer A/PAM with reporter EYFP | Synthetic | Kanamycin | PMID:24076762 | Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:52 | 0 | ||
|
SK-YFP-NM-A Resource Report Resource Website |
RRID:Addgene_48664 | NM prototspacer A/PAM with reporter EYFP | Synthetic | Kanamycin | PMID:24076762 | Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:52 | 0 | ||
|
SK-YFP-TD-B Resource Report Resource Website |
RRID:Addgene_48663 | TD prototspacer B/PAM with reporter EYFP | Synthetic | Kanamycin | PMID:24076762 | Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:52 | 0 | ||
|
SK-YFP-SPNM-B Resource Report Resource Website |
RRID:Addgene_48661 | SP/NM prototspacer B/PAM with reporter EYFP | Synthetic | Kanamycin | PMID:24076762 | Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:52 | 0 | ||
|
pGGA004 Resource Report Resource Website |
RRID:Addgene_48815 | 35S promoter | Synthetic | Ampicillin | PMID:24376629 | This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp 35S promoter = 2252-3115bp BsaI site #2 = 3116-3126bp | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin | internal BsaI recognition site removed by substitution | 2026-08-15 01:15:53 | 0 |
|
8xLexA-binding elements/pMD20 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48807 | 8xLexA-binding elements | Synthetic | Ampicillin | PMID:22043306 | Backbone Marker:Takara Bio; Backbone Size:2736; Vector Backbone:pMD20; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:53 | 2 | ||
|
pPy-CAG-Cre::ERT2-IRES-BSD Resource Report Resource Website 1+ mentions |
RRID:Addgene_48760 | Cre::ERT2 | Synthetic | Ampicillin | PMID:23582324 | Backbone Size:6100; Vector Backbone:Bluescript; Vector Types:Mammalian Expression, pPy; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:54 | 3 | ||
|
pGGD005 Resource Report Resource Website |
RRID:Addgene_48853 | Linker:BFP | Synthetic | Ampicillin | PMID:24376629 | This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp linker-BFP = 2252-3066bp BsaI site #2 = 3067-3077bp | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:54 | 0 | |
|
pGGG002 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48851 | H-A adapter - short | Synthetic | Ampicillin | PMID:24376629 | This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp H-A adapter = 2252-2271bp BsaI site #2 = 2272-2282bp | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:54 | 1 | |
|
pGGG001 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48850 | F-H adapter - short | Synthetic | Ampicillin | PMID:24376629 | This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp F-H adapter = 2252-2271bp BsaI site #2 = 2272-2282bp | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:54 | 1 | |
|
pGGF012 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48849 | pMAS::SulfadiazineR::t35S | Synthetic | Ampicillin | PMID:24376629 | This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp Sulfadiazine resistance cassette with MAS promoter and 35S terminator = 2252-3882bp BsaI site #2 = 3883-3893bp | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin | internal BsaI recognition sites in SulfR removed by silent substitutions | 2026-08-15 01:15:54 | 1 |
|
pGGF008 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48848 | pNOS::BastaR::tNOS | Synthetic | Ampicillin | PMID:24376629 | This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp BASTA resistance cassette with NOS promoter and terminator = 2252-3334bp BsaI site #2 = 3335-3345bp | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin | chi sequence in BastaR removed by silent substitution | 2026-08-15 01:15:54 | 1 |
|
pGGC026 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48831 | 3xmCherry | Synthetic | Ampicillin | PMID:24376629 | This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp 3x mCherry coding sequence = 2252-4491bp BsaI site #2 = 4492-4502bp | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:54 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.