Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:arabidopsis thaliana (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,244 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pGWB414_35S-DM3(Hh-0)-HA
 
Resource Report
Resource Website 		RRID:Addgene_229711 DM3(Hh-0) Arabidopsis thaliana Spectinomycin PMID:40680723 Please visit https://doi.org/10.1101/2024.10.28.620575 for bioRxiv preprint. Backbone Marker:Tsuyoshi Nakagawa (Addgene plasmid #74856); Vector Backbone:pGWB414; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:34:49 0
pENTR-BS-AtMIR390a-A18G-B/c
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_246715 Basal stem of Arabidopsis MIR390a precursor with A18G mutation and a chloramphenicol-ccdB cassette flanked by 2 BsaI sites Arabidopsis thaliana Chloramphenicol and Kanamycin PMID:41505763 Backbone Size:2580; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Kanamycin 2026-08-15 01:34:50 1
pSTTa-GPA1-Q222L
 
Resource Report
Resource Website 		RRID:Addgene_248650 GPA1 Arabidopsis thaliana Ampicillin PMID:40260404 Additional details regarding the physiological roles of this mutant GPA1 protein can be found at PMID: 31690635. Backbone Marker:GE Healthcare; Backbone Size:4523; Vector Backbone:pSTTa (from pGEX); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Q222L 2026-08-15 01:34:50 0
pHAGE-dCas9-3XGFP-CRY2
 
Resource Report
Resource Website 		RRID:Addgene_249578 CRY2hiclu Arabidopsis thaliana Ampicillin PMID:41549960 Please refer to related article for further details about origin and use of this plasmid. CRY2 was cloned into vector made by Thoru Pederson lab (Addgene #64107). Please visit https://doi.org/10.1101/2025.11.06.686574 for bioRxiv preprint. Backbone Size:6607; Vector Backbone:pHAGE-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:34:51 0
pSTTa-GPA1
 
Resource Report
Resource Website 		RRID:Addgene_248648 GPA1 Arabidopsis thaliana Ampicillin PMID:40260404 Backbone Marker:GE Healthcare; Backbone Size:4523; Vector Backbone:pSTTa (from pGEX); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:34:50 0
pSTTa-GPA1-S52N
 
Resource Report
Resource Website 		RRID:Addgene_248649 GPA1 Arabidopsis thaliana Ampicillin PMID:40260404 Additional details regarding the physiological roles of this mutant GPA1 protein can be found at PMID: 31690635. Backbone Marker:GE Healthcare; Backbone Size:4523; Vector Backbone:pSTTa (from pGEX); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin S52N 2026-08-15 01:34:52 0
pACYCDuet-AtTIR1P10A-Myc-MBP-HA
 
Resource Report
Resource Website 		RRID:Addgene_228943 AtTIR1P10A Arabidopsis thaliana Chloramphenicol PMID:39456142 Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:35:14 0
pETDuet-1-AtRBX1-T7-HsSKP1-T7-AtCUL1-S
 
Resource Report
Resource Website 		RRID:Addgene_228944 AtRBX1 Arabidopsis thaliana Ampicillin PMID:39456142 Vector Backbone:pETDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:35:14 0
pAGM9121_CENH3-cds
 
Resource Report
Resource Website 		RRID:Addgene_232568 AtCENH3 Arabidopsis thaliana Spectinomycin PMID:41918164 Backbone Marker:Sylvestre Marillonnet (Addgene plasmid # 51833); Vector Backbone:pAGM9121; Vector Types:Coding Sequence; Bacterial Resistance:Spectinomycin 2026-08-15 01:35:20 0
pICH41295_EC1.1-pro
 
Resource Report
Resource Website 		RRID:Addgene_232552 EC1.1 promoter Arabidopsis thaliana Spectinomycin PMID:41918164 Backbone Marker:Sylvestre Marillonnet (Addgene plasmid # 47997); Vector Backbone:pICH41295; Vector Types:Promoter; Bacterial Resistance:Spectinomycin 2026-08-15 01:35:20 0
pICH41295_A9-pro
 
Resource Report
Resource Website 		RRID:Addgene_232553 A9 promoter Arabidopsis thaliana Spectinomycin PMID:41918164 Backbone Marker:Sylvestre Marillonnet (Addgene plasmid # 47997); Vector Backbone:pICH41295; Vector Types:Promoter; Bacterial Resistance:Spectinomycin 2026-08-15 01:35:20 0
pAGM1299_BPM1
 
Resource Report
Resource Website 		RRID:Addgene_232570 BPM1 Arabidopsis thaliana Spectinomycin PMID:41918164 Backbone Marker:Sylvestre Marillonnet (Addgene plasmid # 47988); Vector Backbone:pAGM1299; Vector Types:Coding Sequence; Bacterial Resistance:Spectinomycin 2026-08-15 01:35:20 0
pICH41258_SLY1
 
Resource Report
Resource Website 		RRID:Addgene_232573 SLY1 Arabidopsis thaliana Spectinomycin PMID:41918164 Backbone Marker:Sylvestre Marillonnet (Addgene plasmid # 47987); Vector Backbone:pICH41258; Vector Types:Coding Sequence; Bacterial Resistance:Spectinomycin 2026-08-15 01:35:20 0
pICH41258_ETO1
 
Resource Report
Resource Website 		RRID:Addgene_232574 ETO1 Arabidopsis thaliana Spectinomycin PMID:41918164 Backbone Marker:Sylvestre Marillonnet (Addgene plasmid # 47987); Vector Backbone:pICH41258; Vector Types:Coding Sequence; Bacterial Resistance:Spectinomycin 2026-08-15 01:35:20 0
pZZ006-AlcA::DM2h[Bla-1] S111A H112A-Myc
 
Resource Report
Resource Website 		RRID:Addgene_246382 DM2h[Bla-1] Arabidopsis thaliana Spectinomycin Vector Backbone:pZZ006; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin CCATTCTTAGTCACATCCTCGAA to AAAACCATTCTTGCTGCTATCCTCGAA amino acid S111A H112A 2026-08-15 01:35:44 0
pB2K-B1P
 
Resource Report
Resource Website 		RRID:Addgene_256023 BSL2/BSL1 chimera Arabidopsis thaliana Kanamycin PMID:42412928 Vector Backbone:pCambia-3300; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin chimera 2026-08-15 01:35:50 0
pTOPP1
 
Resource Report
Resource Website 		RRID:Addgene_256029 TOPP1 Arabidopsis thaliana Kanamycin PMID:42412928 Vector Backbone:pCambia-3300; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin WT 2026-08-15 01:35:50 0
PCS2-CIB1-RFP-IFT88
 
Resource Report
Resource Website 		RRID:Addgene_248077 CIB1 Arabidopsis thaliana Ampicillin Backbone Marker:Dave Turner lab (UMich); Backbone Size:4090; Vector Backbone:PCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin none 2026-08-15 01:34:32 0
EML8359_pA3A-CBECas9-ALSpro197
 
Resource Report
Resource Website 		RRID:Addgene_234353 ALS Arabidopsis thaliana Kanamycin PMID:41321035 Vector Backbone:EML8357_pA3A-CBECas9; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:34:33 0
pGGE-AtREF6jmj
 
Resource Report
Resource Website 		RRID:Addgene_246814 AtREF6jmj Arabidopsis thaliana Ampicillin Backbone Size:2686; Vector Backbone:pGGE000; Vector Types:GreenGate cloning entry vector; Bacterial Resistance:Ampicillin 2026-08-15 01:34:36 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch