Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:synthetic (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

30,421 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
RAP1-bio
 
Resource Report
Resource Website
RRID:Addgene_47794 Codon-optimised RAP1 Synthetic Ampicillin PMID:24043421 Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Exogenous signal peptide of mouse origin, changed Serine74, Threonine84, Serine92, Serine170, Threonine329, Serine357 and Threonine404 to Alanine residues 2026-08-15 01:15:44 0
PF3D7_1431400-bio
 
Resource Report
Resource Website
RRID:Addgene_47791 Codon-optimised PF3D7_1431400 Synthetic Ampicillin PMID:24043421 Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Exogenous signal peptide of mouse origin, changed Serine27, Serine31, Serine35, Threonine70, Serine102, Serine103, Serine300, Threonine309, Threonine313, Threonine387, Serine481, Serine497, Serine498, Serine502, Serine513, Serine551, Serine574, Threonine622, Threonine644, Serine732, Serine743, Serine785 and Serine962 to Alanine residues 2026-08-15 01:15:44 0
EBL1-bio
 
Resource Report
Resource Website
RRID:Addgene_47792 Codon-optimised EBL1 Synthetic Ampicillin PMID:24043421 Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Exogenous signal peptide of mouse origin, changed Serine37, Serine53, Serine150, Serine255, Threonine313, Serine722, Serine845, Serine957, Serine1010, Serine1175, Serine1220, Serine1239, Serine1325, Threonine1346, Serine1352, Serine1606, Threonine1798, Serine1829, Serine2161, Serine2310, Serine2356, Serine2403, Threonine2426, Threonine2432, Serine2480, Serine2508, Threonine2518, Serine2560 and Threonine2573 to Alanine residues 2026-08-15 01:15:45 0
pMB66
 
Resource Report
Resource Website
RRID:Addgene_47946 Cas9 Synthetic Ampicillin PMID:23979586 To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:46 0
pMB62
 
Resource Report
Resource Website
RRID:Addgene_47944 Cas9 Synthetic Ampicillin PMID:23979586 To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:47 0
pMB63
 
Resource Report
Resource Website
RRID:Addgene_47945 Cas9 Synthetic Ampicillin PMID:23979586 To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:46 0
pMB70
 
Resource Report
Resource Website
RRID:Addgene_47943 guide RNA Synthetic Kanamycin PMID:23979586 Backbone Marker:Geneart; Vector Backbone:pMK; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:15:46 0
pIK86
 
Resource Report
Resource Website
RRID:Addgene_47933 Cas9 Synthetic Ampicillin PMID:23979578 Backbone Size:2730; Vector Backbone:pUC57; Vector Types:CRISPR, Unspecified; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 0
pcDNA-T1ER
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_47928 T1ER Synthetic Ampicillin PMID:23838183 Ratiometric calcium sensor targeted to ER with KDEL sequence. The CFP fragment of Addgene plasmid 36325 pcDNA-D1ER was replaced with the brighter fluorescent protein mTurquoise. Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin KDEL 2026-08-15 01:15:47 2
pCS2-nCas9n
 
Resource Report
Resource Website
100+ mentions
RRID:Addgene_47929 nls-zcas9-nls Synthetic Ampicillin PMID:23918387 Note from depositor: Although this plasmid produces smaller transcripts in addition to the expected one, the product mixture displays activity comparable to that from pT3TS-nCas9n. For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 103
pFAB1935
 
Resource Report
Resource Website
RRID:Addgene_47860 his_T_min_linker_crp_T_min double terminator Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 99% (97% and 73% alone, respectively). Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB777; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin concatenate of his_min and crp_min 2026-08-15 01:15:46 0
pFAB1902
 
Resource Report
Resource Website
RRID:Addgene_47858 M13_central_T_linker_rrnD_T1 double terminator Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 100% (97% and 99% alone, respectively). Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB775; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin concatenate of M13 central and rrnD 2026-08-15 01:15:45 0
pFAB816
 
Resource Report
Resource Website
RRID:Addgene_47851 ilvGEDA Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 99%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB768; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:46 0
pFAB1907
 
Resource Report
Resource Website
RRID:Addgene_47857 BBa_B1006 U10 Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 99%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB774; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin Added two extra U at the end of Bba_1006 poly-U tail 2026-08-15 01:15:46 0
pTrex-Neo-tdTomato
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_47975 tdTomato Synthetic Ampicillin PMID:20644616 Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. 2004;22:1567–1572 Vazquez MP, Levin MJ (1999) Functional analysis of the intergenic regions of TcP2beta gene loci allowed the construction of an improved Trypanosoma cruzi expression vector. Gene 239: 217–225. doi: 10.1016/S0378-1119(99)00386-8. Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex-Neo; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:47 3
pFAB820
 
Resource Report
Resource Website
RRID:Addgene_47855 tetAC terminator Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 50%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB772; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:45 0
pFAB806
 
Resource Report
Resource Website
RRID:Addgene_47849 lambda tR2 terminator Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 91%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB766; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:45 0
pFAB803
 
Resource Report
Resource Website
RRID:Addgene_47847 T7 early terminator Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 96%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB764; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:45 0
pFAB804
 
Resource Report
Resource Website
RRID:Addgene_47848 T3 early terminator Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 94%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB765; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:46 0
pFAB3893
 
Resource Report
Resource Website
RRID:Addgene_47844 promoter 13 and BCD1 Synthetic Kanamycin PMID:23474465 http://biofab.org/services RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 48.98 Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:46 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.