Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
RAP1-bio Resource Report Resource Website |
RRID:Addgene_47794 | Codon-optimised RAP1 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine74, Threonine84, Serine92, Serine170, Threonine329, Serine357 and Threonine404 to Alanine residues | 2026-08-15 01:15:44 | 0 | |
|
PF3D7_1431400-bio Resource Report Resource Website |
RRID:Addgene_47791 | Codon-optimised PF3D7_1431400 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine27, Serine31, Serine35, Threonine70, Serine102, Serine103, Serine300, Threonine309, Threonine313, Threonine387, Serine481, Serine497, Serine498, Serine502, Serine513, Serine551, Serine574, Threonine622, Threonine644, Serine732, Serine743, Serine785 and Serine962 to Alanine residues | 2026-08-15 01:15:44 | 0 | |
|
EBL1-bio Resource Report Resource Website |
RRID:Addgene_47792 | Codon-optimised EBL1 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine37, Serine53, Serine150, Serine255, Threonine313, Serine722, Serine845, Serine957, Serine1010, Serine1175, Serine1220, Serine1239, Serine1325, Threonine1346, Serine1352, Serine1606, Threonine1798, Serine1829, Serine2161, Serine2310, Serine2356, Serine2403, Threonine2426, Threonine2432, Serine2480, Serine2508, Threonine2518, Serine2560 and Threonine2573 to Alanine residues | 2026-08-15 01:15:45 | 0 | |
|
pMB66 Resource Report Resource Website |
RRID:Addgene_47946 | Cas9 | Synthetic | Ampicillin | PMID:23979586 | To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. | Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:46 | 0 | |
|
pMB62 Resource Report Resource Website |
RRID:Addgene_47944 | Cas9 | Synthetic | Ampicillin | PMID:23979586 | To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 | Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:47 | 0 | |
|
pMB63 Resource Report Resource Website |
RRID:Addgene_47945 | Cas9 | Synthetic | Ampicillin | PMID:23979586 | To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 | Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:46 | 0 | |
|
pMB70 Resource Report Resource Website |
RRID:Addgene_47943 | guide RNA | Synthetic | Kanamycin | PMID:23979586 | Backbone Marker:Geneart; Vector Backbone:pMK; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:46 | 0 | ||
|
pIK86 Resource Report Resource Website |
RRID:Addgene_47933 | Cas9 | Synthetic | Ampicillin | PMID:23979578 | Backbone Size:2730; Vector Backbone:pUC57; Vector Types:CRISPR, Unspecified; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:45 | 0 | ||
|
pcDNA-T1ER Resource Report Resource Website 1+ mentions |
RRID:Addgene_47928 | T1ER | Synthetic | Ampicillin | PMID:23838183 | Ratiometric calcium sensor targeted to ER with KDEL sequence. The CFP fragment of Addgene plasmid 36325 pcDNA-D1ER was replaced with the brighter fluorescent protein mTurquoise. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | KDEL | 2026-08-15 01:15:47 | 2 |
|
pCS2-nCas9n Resource Report Resource Website 100+ mentions |
RRID:Addgene_47929 | nls-zcas9-nls | Synthetic | Ampicillin | PMID:23918387 | Note from depositor: Although this plasmid produces smaller transcripts in addition to the expected one, the product mixture displays activity comparable to that from pT3TS-nCas9n. For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ | Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:45 | 103 | |
|
pFAB1935 Resource Report Resource Website |
RRID:Addgene_47860 | his_T_min_linker_crp_T_min double terminator | Synthetic | Kanamycin | PMID:23474465 | Terminator efficiency measured at 99% (97% and 73% alone, respectively). Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. | Backbone Size:3967; Vector Backbone:pFAB777; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | concatenate of his_min and crp_min | 2026-08-15 01:15:46 | 0 |
|
pFAB1902 Resource Report Resource Website |
RRID:Addgene_47858 | M13_central_T_linker_rrnD_T1 double terminator | Synthetic | Kanamycin | PMID:23474465 | Terminator efficiency measured at 100% (97% and 99% alone, respectively). Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. | Backbone Size:3967; Vector Backbone:pFAB775; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | concatenate of M13 central and rrnD | 2026-08-15 01:15:45 | 0 |
|
pFAB816 Resource Report Resource Website |
RRID:Addgene_47851 | ilvGEDA | Synthetic | Kanamycin | PMID:23474465 | Terminator efficiency measured at 99%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. | Backbone Size:3967; Vector Backbone:pFAB768; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:46 | 0 | |
|
pFAB1907 Resource Report Resource Website |
RRID:Addgene_47857 | BBa_B1006 U10 | Synthetic | Kanamycin | PMID:23474465 | Terminator efficiency measured at 99%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. | Backbone Size:3967; Vector Backbone:pFAB774; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | Added two extra U at the end of Bba_1006 poly-U tail | 2026-08-15 01:15:46 | 0 |
|
pTrex-Neo-tdTomato Resource Report Resource Website 1+ mentions |
RRID:Addgene_47975 | tdTomato | Synthetic | Ampicillin | PMID:20644616 | Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. 2004;22:1567–1572 Vazquez MP, Levin MJ (1999) Functional analysis of the intergenic regions of TcP2beta gene loci allowed the construction of an improved Trypanosoma cruzi expression vector. Gene 239: 217–225. doi: 10.1016/S0378-1119(99)00386-8. | Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex-Neo; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:47 | 3 | |
|
pFAB820 Resource Report Resource Website |
RRID:Addgene_47855 | tetAC terminator | Synthetic | Kanamycin | PMID:23474465 | Terminator efficiency measured at 50%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. | Backbone Size:3967; Vector Backbone:pFAB772; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:45 | 0 | |
|
pFAB806 Resource Report Resource Website |
RRID:Addgene_47849 | lambda tR2 terminator | Synthetic | Kanamycin | PMID:23474465 | Terminator efficiency measured at 91%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. | Backbone Size:3967; Vector Backbone:pFAB766; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:45 | 0 | |
|
pFAB803 Resource Report Resource Website |
RRID:Addgene_47847 | T7 early terminator | Synthetic | Kanamycin | PMID:23474465 | Terminator efficiency measured at 96%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. | Backbone Size:3967; Vector Backbone:pFAB764; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:45 | 0 | |
|
pFAB804 Resource Report Resource Website |
RRID:Addgene_47848 | T3 early terminator | Synthetic | Kanamycin | PMID:23474465 | Terminator efficiency measured at 94%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. | Backbone Size:3967; Vector Backbone:pFAB765; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:46 | 0 | |
|
pFAB3893 Resource Report Resource Website |
RRID:Addgene_47844 | promoter 13 and BCD1 | Synthetic | Kanamycin | PMID:23474465 | http://biofab.org/services RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 48.98 | Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:46 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
