Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: GAL1 promoter
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Comments: GFP in Addgene plasmid #41614 was replaced with stable GFP variant (F64L, S65T, V163A).
Proper citation: RRID:Addgene_53205 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TRP1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17942599
Comments: This plasmid is similar to Addgene plasmid #41597, except the GFP has been switched to a more stable variant.
Proper citation: RRID:Addgene_53184 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HIs3MX6
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17942599
Comments: This plasmid is similar to Addgene plasmid #41598, except the GFP has been switched to a more stable variant.
Proper citation: RRID:Addgene_53185 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SET1
Vector Backbone Description: Backbone Size:6442; Vector Backbone:pGLx2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22851644
Proper citation: RRID:Addgene_53257 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: sgRNA targeting endogenous TRE elements of pTET07 promoter
Vector Backbone Description: Backbone Size:5083; Vector Backbone:AH057; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence TATCAGTGATAGAGAAAAGT
Proper citation: RRID:Addgene_46923 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Codon-optimized sequences for MEV pathway expression in E. coli to produce limonene
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pBbA5a; Vector Types:Bacterial Expression, Synthetic Biology, BglBrick; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23727191
Comments: The R364S mutation in the MK is not known to alter the function. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_47049 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MepTrac-H194E
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pDR GW; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23840931
Proper citation: RRID:Addgene_47764 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: meptrac
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pDR GW; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23840931
Proper citation: RRID:Addgene_47768 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: YeLuc
Vector Backbone Description: Backbone Marker:DNA 2.0; Backbone Size:2707; Vector Backbone:pJ204; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010
Proper citation: RRID:Addgene_60115 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GrLuc
Vector Backbone Description: Backbone Marker:DNA 2.0; Backbone Size:2707; Vector Backbone:pJ204; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010
Proper citation: RRID:Addgene_60114 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: promoter
Vector Backbone Description: Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22565375
Proper citation: RRID:Addgene_60328 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: promoter
Vector Backbone Description: Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22565375
Proper citation: RRID:Addgene_60327 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB2
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327
Proper citation: RRID:Addgene_60401 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB2
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327
Comments: C-terminal tail is from TUBB6 (tubulin, beta 6 class V) according to HUGO nomenclature: http://www.genenames.org/genefamilies/TUB
Proper citation: RRID:Addgene_60403 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB2
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327
Comments: Johnson V, Ayaz P, Huddleston P, Rice LM.
Design, overexpression, and purification of polymerization-blocked yeast αβ-tubulin mutants.
Biochemistry. 2011 Oct 11;50(40):8636-44. doi: 10.1021/bi2005174. Epub 2011 Sep 16.
Proper citation: RRID:Addgene_60386 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB2
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327
Proper citation: RRID:Addgene_60399 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB2
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327
Proper citation: RRID:Addgene_60398 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB1
Vector Backbone Description: Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327
Proper citation: RRID:Addgene_60392 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB2
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327
Proper citation: RRID:Addgene_60397 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB2
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327
Proper citation: RRID:Addgene_60396 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
